Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TTGAAGATTGGCCTCTTTCCTTTCTCTAAGACAAACCTAAGTAAAAGCCTGAGCTTTGAGTCCTATGCTCAGCACACGGGAAGGAGATGTTAATAATTAAAATAAAGTTGATATCCTGTCTTTAGGGAGTTCCCTTGATCTCTTGAAAGAGACACAGCCCCATTTACATTATTTCGTGGATTTCACCAGCATAGTATAGTTTTTTTCTGTAAGTCCCTCATTCTTATGTAATAACAGGTGGAACTGAGGTTTGAAGAACCTCAGTGGCCCATCCTGATGACATTGGAGACTCAAAGAGACAAGAGAGAGTAGGGTTTAAAACCTGAGCTTTAAGACTCCCACTAGCTTCGTGTCCTTTGGCATGTTAACGTGCCTCAGTTTCCTCATCTGTATAATGGGGATATATGAAAGGCACCAGTCCTAAGG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... FTO(79068)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Dong Xu et al.
Oncology reports, 38(4), 2285-2292 (2017-08-30)
Fat mass and obesity associated (FTO) is a protein-coding gene. FTO gene is an obesity related gene, also known as the obesity gene. It has been reported previously that FTO is associated with a variety of malignant cancers, such as
Ziqi Ye et al.
Oncology letters, 20(2), 1409-1417 (2020-07-30)
Liver cancer is the fourth leading cause of cancer-associated mortality worldwide. Statistics indicate that the incidence of liver cancer has been increasing and that its prognosis remains poor. Fat mass and obesity-associated protein (FTO) is a demethylase that is involved
Ruifan Wu et al.
Biochimica et biophysica acta. Gene regulatory mechanisms, 1862(8), 796-806 (2019-07-12)
N6-methyladenosine (m6A), the most abundant internal mRNA modification in eukaryotes, plays a vital role in regulating adipogenesis. However, its underlying mechanism remains largely unknown. Here, we reveal that deletion of m6A demethylase FTO in porcine and mouse preadipocytes inhibits adipogenesis