Skip to Content
Merck

EHU113921

MISSION® esiRNA

targeting human ATG4B

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGCAGCCAGACAGCTACTTCAGCGTCCTCAACGCATTCATCGACAGGAAGGACAGTTACTACTCCATTCACCAGATAGCGCAAATGGGAGTTGGCGAAGGCAAGTCCATAGGCCAGTGGTACGGGCCCAACACTGTCGCCCAGGTCCTGAAGAAGCTTGCTGTCTTCGATACGTGGAGCTCCTTGGCGGTCCACATTGCAATGGACAACACTGTTGTGATGGAGGAAATCAGAAGGTTGTGCAGGACCAGCGTTCCCTGTGCAGGCGCCACTGCGTTTCCTGCAGATTCCGACCGGCACTGCAACGGATTCCCTGCCGGAGCTGAGGTCACCAACAGGCCGTCGCCATGGAGACCCCTGGTACTTCTCATTCCCCTGCGCCTGGGGCTCACGGACATCAACGAGGCCTACGT

Ensembl | human accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ATG4B(23192)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Yao-Xin Lin et al.
Biomaterials, 141, 199-209 (2017-07-10)
Autophagic therapy is regarded as a promising strategy for disease treatment. Appropriate autophagy regulations in vivo play a crucial role in translating this new concept from benchside to bedside. So far, emerging technologies are required to spatially and quantitatively monitor autophagic
Pei-Feng Liu et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 44(2), 728-740 (2017-11-24)
ATG4B is a cysteine protease required for autophagy, which is a cellular catabolic pathway involved in energy balance. ATG4B expression is elevated during tumor growth in certain types of cancer, suggesting that ATG4B is an attractive target for cancer therapy.
Yao-Xin Lin et al.
ACS nano, 11(2), 1826-1839 (2017-01-24)
Autophagy plays a crucial role in the metabolic process. So far, conventional methods are incapable of rapid, precise, and real-time monitoring of autophagy in living objects. Herein, we describe an in situ intracellular self-assembly strategy for quantitative and temporal determination