Skip to Content
Merck

EHU137721

MISSION® esiRNA

targeting human GATA3

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGACGAGAAAGAGTGCCTCAAGTACCAGGTGCCCCTGCCCGACAGCATGAAGCTGGAGTCGTCCCACTCCCGTGGCAGCATGACCGCCCTGGGTGGAGCCTCCTCGTCGACCCACCACCCCATCACCACCTACCCGCCCTACGTGCCCGAGTACAGCTCCGGACTCTTCCCCCCCAGCAGCCTGCTGGGCGGCTCCCCCACCGGCTTCGGATGCAAGTCCAGGCCCAAGGCCCGGTCCAGCACAGGCAGGGAGTGTGTGAACTGTGGGGCAACCTCGACCCCACTGTGGCGGCGAGATGGCACGGGACACTACCTGTGCAACGCCTGCGGGCTCTATCACAAAATGAACGGACAGAACCGGCCCCTCATTAAGCCCAAGCGAAGGCTGTCTGCAGCCAGGAGAGCAGGGACGTCCTGTGCGAACTGTCAGAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... GATA3(2625)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Yinghua Xu et al.
Oncotarget, 8(66), 110517-110529 (2018-01-05)
Lung adenocarcinoma (LAC) is the leading cause of cancer-related death worldwide. Aberrant expression of genes expressed preferentially in the lung tumor vasculature may yield clues for prognosis and treatment. Von Willebrand factor (vWF) is a large multifunctional glycoprotein with a
Linjie Ma et al.
OncoTargets and therapy, 11, 7579-7589 (2018-11-23)
GATA3 functions as a tumor suppressor and has been observed in multiple types of cancer, but the effects and mechanisms of GATA3 in osteosarcoma (OS) are not yet known. The GATA3 expression in OS cells and tissues were detected using
P Shahi et al.
Oncogene, 36(40), 5567-5575 (2017-06-06)
Semaphorin 3B (SEMA3B) is a secreted axonal guidance molecule that is expressed during development and throughout adulthood. Recently, SEMA3B has emerged as a tumor suppressor in non-neuronal cells. Here, we show that SEMA3B is a direct target of GATA3 transcriptional