Skip to Content
Merck

EMU079511

MISSION® esiRNA

targeting mouse Atf4

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCGATGCTCTGTTTCGAATGGATGACCTGGAAACCATGCCAGATGAGCTCTTGACCACGTTGGATGACACATGTGATCTTTTTGCCCCTCTAGTCCAAGAGACTAATAAGGAGCCCCCTCAGACAGTGAACCCAATTGGCCATCTCCCAGAAAGTTTAATAAAAGTCGACCAGGTTGCCCCCTTTACATTCTTGCAGCCTTTCCCCTGTTCCCCAGGGGTTCTGTCTTCCACTCCAGAGCATTCCTTTAGTTTAGAGCTAGGCAGTGAAGTTGATATCTCTGAAGGAGACAGGAAGCCTGACTCTGCTGCTTACATTACTCTAATCCCTCCATGTGTAAAGGAGGAAGACACTCCCTCTGACAATGACAGTGGCATCTGTATGAGCCCGGAGTCCTACCTGGGCTCTCCCCAGCATAGCCCCTCCACCTCCAGGGCCCCACCAGACAATCTGCCTTCTCCAGG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Hui Zhang et al.
Journal of translational medicine, 13, 178-178 (2015-06-05)
Anti-dsDNA antibodies play an important role in the pathogenesis of lupus nephritis (LN). Endoplasmic reticulum (ER) stress is a physical reaction under stressful condition and can cause inflammation when stimulation is sustained. This study investigated the roles of ER stress
Kyong-Jin Jung et al.
Oncotarget, 6(3), 1556-1568 (2015-01-19)
Carnosic acid is a phenolic diterpene from rosmarinus officinalis, and has multiple functions, such as anti-inflammatory, anti-viral, and anti-tumor activity. In this study, we examined whether carnosic acid could sensitize TRAIL-mediated apoptosis in human renal carcinoma Caki cells. We found
Enni Markkanen et al.
Nucleic acids research, 43(7), 3667-3679 (2015-03-25)
Genetic instability, provoked by exogenous mutagens, is well linked to initiation of cancer. However, even in unstressed cells, DNA undergoes a plethora of spontaneous alterations provoked by its inherent chemical instability and the intracellular milieu. Base excision repair (BER) is