Skip to Content
Merck

EMU028861

MISSION® esiRNA

targeting mouse Cdkn1c

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

Product Name

MISSION® esiRNA, targeting mouse Cdkn1c

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTTAGAGGCTAACGGCCAGAGAGAACTTGCTGGGCATCTGGGCAGCGGACGATGGAAGAACTCTGGGCTTCGGCTGGGACCTTTCGTTCATGTAGCAGGAACCGGAGATGGTTGCGTAGAGCAGCCCACGGTTTTGTGGAAATCTGAAAACTGTGCAATGTATTGAGAACACTCTGTACCATGTGCAAGGAGTACGCTGGTCCCAAGGTGTAAAGCTTTAAATCATTTATGTAAAATGTTTAATCTCTACTCGCTCTCAGTGCAAAACAAAAAGAGAAACTAGAAAATGTAGAACGAAGGAAAAAGATGAGAAAAAGGAAAAAGCATGTATATTTGTACAAAAAGTTAAAAAATTATGCTAATTTAATATTTGTATTTATCCATGCGTGGATCCCTCTGCCACGCAACTGCTGGGTTATTGATTATTACCAAAGGCACTAGAAATCACCAGCTTCAGATTACCCA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

H M Coley et al.
British journal of cancer, 106(3), 482-489 (2012-01-12)
Carboplatin remains a first-line agent in the management of epithelial ovarian cancer (EOC). Unfortunately, platinum-resistant disease ultimately occurs in most patients. Using a novel EOC cell line with acquired resistance to carboplatin: PEO1CarbR, genome-wide micro-array profiling identified the cyclin-dependent kinase
Elizabeth M Algar et al.
PloS one, 4(2), e4482-e4482 (2009-02-18)
SMARCB1 is deleted in rhabdoid tumor, an aggressive paediatric malignancy affecting the kidney and CNS. We hypothesized that the oncogenic pathway in rhabdoid tumors involved epigenetic silencing of key cell cycle regulators as a consequence of altered chromatin-remodelling, attributable to
Hui Guo et al.
BMC gastroenterology, 15, 104-104 (2015-08-15)
Our previous research suggested that p57 downregulation could accelerate the growth and invasion of hepatocellular carcinoma in vitro and in vivo. To evaluate the role of cytoplasmic p57 and its regulatory mechanism during hepatocellular carcinoma invasion. We examined the subcellular
Jihong Zhang et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 71, 7-14 (2015-05-12)
MicroRNAs (miRNA) have oncogenic or tumor-suppressive roles in the development and growth of human glioma. Glioma development is also associated with alteration in the activities and expression of cell cycle regulators, and miRNAs are emerging as important regulators of cell

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service