Saltar al contenido
Merck

EHU009041

MISSION® esiRNA

targeting human FIGN

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño


Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGGCTCTGACAAACAGTTCAGCAAGTTCTCTCAAAAGGAAAGCTTTCTACATGGCAGGGCAAGGAGATATGGACTCCAGTTATGGAAATTACAGCTATGGCCAACAGAGATCTACACAGAGTCCTATGTACAGAATGCCCGACAACAGCATTTCAAACACAAATCGGGGGAATGGCTTTGACAGAAGTGCTGAAACATCATCCTTAGCATTTAAGCCAACGAAGCAGCTAATGTCCTCTGAACAGCAAAGGAAATTCAGCAGCCAGTCCAGTAGGGCTCTGACCCCTCCTTCCTACAGTACTGCTAAAAATTCATTGGGATCAAGATCCAGTGAATCCTTTGGGAAGTACACATCGCCAGTAATGAGTGAGCATGGGGACGAGCACAGGCAGCTCCTCTCTCACCCAATGCAAGGCCCTGGACTCCGTGCAGCTACCTCATCCAACCACTCTGTGGACGAGCAACTGAAGAATACTGACACGCACCTCATCGACCTGGTAACCAATGAGATTATCACCCAAGGACCTCCAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Xi-Feng Jin et al.
Cancers, 12(2) (2020-02-09)
Inhibition of Wnt/β-catenin signaling by specific inhibitors is currently being investigated as an antitumoral strategy for various cancers. The role of Wnt/β-catenin signaling in neuroendocrine tumors still needs to be further investigated. This study investigated the antitumor activity of the
Hye-Lim Lee et al.
International journal of molecular sciences, 19(10) (2018-10-17)
Distal-less homeobox 5 (Dlx5) is a negative regulator of adipogenesis. Dlx5 expression is decreased by adipogenic stimuli, but the mechanisms of Dlx5 downregulation by adipogenic stimuli have not yet been determined. Here, we tested the impact of cAMP/PKA (protein kinase
Jian-Ming Lü et al.
International journal of molecular sciences, 20(2) (2019-01-16)
We have previously shown that ritonavir (RTV), a highly active anti-retroviral therapy (HAART) drug, can cause endothelial dysfunction through oxidative stress. Several antioxidants including ginsenoside Rb1, a compound with antioxidant effect, can effectively block this side effect of RTV in
Xiaolong Yuan et al.
Genes, 9(6) (2018-06-15)
Previous studies suggest that signal transducer and activator of transcription 3 (STAT3) and CCAAT/enhancer binding protein beta (C/EBPβ) play an essential role in ovarian granulosa cells (GCs) for mammalian follicular development. Several C/EBPβ putative binding sites were previously predicted on
Dusan Hrckulak et al.
Genes, 9(9) (2018-09-12)
T-cell factor 4 (TCF4), together with β-catenin coactivator, functions as the major transcriptional mediator of the canonical wingless/integrated (Wnt) signaling pathway in the intestinal epithelium. The pathway activity is essential for both intestinal homeostasis and tumorigenesis. To date, several mouse

Contenido relacionado

Instructions

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico