Saltar al contenido
Merck

EHU010511

MISSION® esiRNA

targeting human VANGL2

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño


Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCAGGAAGAGGAGCAGAAAAACCCCAGGGAGGTGATGGACCCCCGGGAGGCAGCCCAAGCCATCTTTGCATCCATGGCCCGTGCCATGCAGAAGTACCTTCGGACCACCAAGCAGCAGCCCTACCACACCATGGAGAGCATCCTGCAGCACCTTGAATTCTGCATCACGCATGACATGACGCCCAAGGCCTTCTTGGAGCGATACTTGGCGGCTGGACCTACCATCCAGTACCACAAGGAACGCTGGCTGGCCAAACAGTGGACATTGGTGAGCGAGGAGCCGGTGACCAACGGCCTCAAGGATGGCATCGTTTTCCTCTTAAAACGCCAGGACTTCAGCCTGGTGGTCAGCACCAAGAAGGTCCCATTCTTCAAACTCTCCGAGGAATTTGTGGATCCCAAGTCACACAAGTTTGTCATGAGGCTGCAGTC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... VANGL2(57216)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Zhaoming Wu et al.
Cell and tissue research, 366(3), 617-621 (2016-09-04)
Vangl2, one of the core components of the planar cell polarity (PCP) pathway, has an important role in the regulation of morphogenesis in several tissues. Although the expression of Vangl2 has been detected in the developing tooth, its role in
Tania M Puvirajesinghe et al.
Nature communications, 7, 10318-10318 (2016-01-13)
The non-canonical Wnt/planar cell polarity (Wnt/PCP) pathway plays a crucial role in embryonic development. Recent work has linked defects of this pathway to breast cancer aggressiveness and proposed Wnt/PCP signalling as a therapeutic target. Here we show that the archetypal
Sek-Shir Cheong et al.
Frontiers in cell and developmental biology, 8, 577201-577201 (2020-11-17)
VANGL2 is a component of the planar cell polarity (PCP) pathway, which regulates tissue polarity and patterning. The Vangl2 Lp mutation causes lung branching defects due to dysfunctional actomyosin-driven morphogenesis. Since the actomyosin network regulates cell mechanics, we speculated that

Contenido relacionado

Instructions

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico