Iniciar sesión para ver los precios por organización y contrato.
Seleccione un Tamaño
Cambiar Vistas
Acerca de este artículo
NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarledescription
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CTTGGTGTCTGGCAGTCTCATTCAGAATGGACATTCCTGCCACAAGGTTGCAGTAGTGAGAGAAGATAAATTGGAAGCAGTGAAGTCCAAGCTAGCTGTGACTGCCAGCATCCATGTGTACAGCATCCAGAAAGCCATGCTAAAGGACAGTGGGCCTCTGTTCAATACTGACTATGACATCCTTAAAAGCAACTTGCAGAACTGCAGCAAATTTAGTGCTATACAATGTGCAGCTGCCGTCCCTAGAGCTCCTGCTGAATCCTCTTCGTCTTCCAAAAAGTTTGAGCAGTCACATCTTCACATGTCAAGTGAGACACAAGCCAACAATGAGCTGACCACCAATGGTCATGGCCCACCTGCATCCAAGCAGGTTTCCCAGCAGCCCAAAGGAATTATGGGAATGTTTGCCTCCAAAGCTGCTGCTAAAACC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... POLD3(10714)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Clase de almacenamiento
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Elija entre una de las versiones más recientes:
¿Ya tiene este producto?
Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.
Contenido relacionado
Instructions
Xianning Lai et al.
Nature communications, 8, 15983-15983 (2017-07-18)
Failure to restart replication forks stalled at genomic regions that are difficult to replicate or contain endogenous DNA lesions is a hallmark of BRCA2 deficiency. The nucleolytic activity of MUS81 endonuclease is required for replication fork restart under replication stress
Robert L Dilley et al.
Nature, 539(7627), 54-58 (2016-11-04)
Homology-directed DNA repair is essential for genome maintenance through templated DNA synthesis. Alternative lengthening of telomeres (ALT) necessitates homology-directed DNA repair to maintain telomeres in about 10-15% of human cancers. How DNA damage induces assembly and execution of a DNA
Emanuela Tumini et al.
Scientific reports, 6, 38873-38873 (2016-12-16)
DNA replication is essential for cellular proliferation. If improperly controlled it can constitute a major source of genome instability, frequently associated with cancer and aging. POLD1 is the catalytic subunit and POLD3 is an accessory subunit of the replicative Pol