Saltar al contenido
Merck

EHU023011

MISSION® esiRNA

targeting human ID3

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño


Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGCGCTTCCTCATTCTTTGAATCCGCGGCTCCGCGGTCTTCGGCGTCAGACCAGCCGGAGGAAGCCTGTTTGCAATTTAAGCGGGCTGTGAACGCCCAGGGCCGGCGGGGGCAGGGCCGAGGCGGGCCATTTTGAATAAAGAGGCGTGCCTTCCAGGCAGGCTCTATAAGTGACCGCCGCGGCGAGCGTGCGCGCGTTGCAGGTCACTGTAGCGGGACTTCTTTTGGTTTTCTTTCTCTTTGGGGCACCTCTGGACTCACTCCCCAGCATGAAGGCGCTGAGCCCGGTGCGCGGCTGCTACGAGGCGGTGTGCTGCCTGTCGGAACGCAGTCTGGCCATCGCCCGGGGCCGAGGGAAGGGCCCGGCAGCTGAGGAGCCGCTGAGCTTGCTGGACGACATGAACCACTGCTACTCCCGCCTGCGGGAACTGGTACCCGGAGTCCCGAGAGGCACTCAGCTTAGCCAGGTGGAAATCCTACAGCGCGTCATCGACTAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ID3(3399)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Sachindra et al.
Oncotarget, 8(66), 110166-110175 (2018-01-05)
Adaptive resistance to targeted therapy such as BRAF inhibitors represents in melanoma a major drawback to this otherwise powerful treatment. Some of the underlying molecular mechanisms have recently been described: hyperactivation of the BRAF-MAPK pathway, of the AKT pathway, of
Jung-Hee Lee et al.
Nature communications, 8(1), 903-903 (2017-10-14)
MDC1 plays a critical role in the DNA damage response (DDR) by interacting directly with several factors including γ-H2AX. However, the mechanism by which MDC1 is recruited to damaged sites remains elusive. Here, we show that MDC1 interacts with a
Jayanta K Das et al.
PloS one, 9(8), e104159-e104159 (2014-08-05)
Microvascular lesions resulting from endothelial cell dysfunction are produced in the brain, lung, kidney, and retina of patients of complex chronic diseases. The environmental and molecular risk factors which may contribute in the development of microvascular damage are unclear. The

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico