Saltar al contenido
Merck

EHU034701

MISSION® esiRNA

targeting human ROCK1 (2)

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño


Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle

Nombre del producto

MISSION® esiRNA, targeting human ROCK1 (2)

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGGACAGAATCGGACACAGCTGTAAGATTGAGGAAGAGTCACACAGAGATGAGCAAGTCAATTAGTCAGTTAGAGTCCCTGAACAGAGAGTTGCAAGAGAGAAATCGAATTTTAGAGAATTCTAAGTCACAAACAGACAAAGATTATTACCAGCTGCAAGCTATATTAGAAGCTGAACGAAGAGACAGAGGTCATGATTCTGAGATGATTGGAGACCTTCAAGCTCGAATTACATCTTTACAAGAGGAGGTGAAGCATCTCAAACATAATCTCGAAAAAGTGGAAGGAGAAAGAAAAGAGGCTCAAGACATGCTTAATCACTCAGAAAAGGAAAAGAATAATTTAGAGATAGATTTAAACTACAAACTTAAATCATTACAACAACGGTTAGAACAAGAGGTAAATGAACACAAAGTAACCAAAGCTCGTTTAACTGACAAACATCAATCTATTGAAGAGGCAAAGTCTGTGGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Dongmei Wang et al.
OncoTargets and therapy, 13, 361-370 (2020-02-06)
Propofol has been identified to perform anti-tumor functions in glioma. However, the molecular mechanisms underlying propofol-induced prevention on migration and invasion of glioma cells remain unclear. Cell proliferation, invasion and migration were measured by 3-(4,5)-dimethylthiahiazo(-z-y1)-3,5-di-phenytetrazoliumromide assay and transwell assay, respectively.
Jialing Rao et al.
Scientific reports, 7, 39727-39727 (2017-01-06)
A recent study demonstrated that advanced glycation end products (AGEs) play a role in monocyte infiltration in mesangial areas in diabetic nephropathy. The Ras homolog gene family, member A Rho kinase (RhoA/ROCK) pathway plays a role in regulating cell migration.
Wen-Di Zhou et al.
International journal of oncology, 51(6), 1831-1841 (2017-10-19)
Actein is a tetracyclic triterpenoid compound, extracted from the rhizome of Cimicifuga foetida, exhibiting anticancer activities as previously reported. However, the effects of actein on human leukemia have not been explored before. In this study, the role of actein in
Ji-Gang Zhang et al.
Biochimica et biophysica acta. Molecular basis of disease, 1865(6), 1113-1125 (2019-02-20)
Vasculogenic mimicry (VM) results in the formation of an alternative circulatory system that can improve the blood supply to multiple malignant tumors, including hepatocellular carcinoma (HCC). However, the potential mechanisms of RhoC/ROCK in VM have not yet been investigated in
Yong Wang et al.
Molecular cancer, 17(1), 89-89 (2018-05-14)
Accumulating evidences indicate that non-coding RNAs (ncRNAs) including long non-coding RNAs (lncRNAs) and microRNAs (miRNAs) acting as crucial regulators in osteosarcoma (OS). Previously, we reported that Rho associated coiled-coil containing protein kinase 1 (ROCK1), a metastatic-related gene was negatively regulated

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico