Saltar al contenido
Merck

EHU047031

MISSION® esiRNA

targeting human MMP8

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño


Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GACAATTCATGGAGCCAGGTTATCCCAAAAGCATATCAGGTGCCTTTCCAGGAATAGAGAGTAAAGTTGATGCAGTTTTCCAGCAAGAACATTTCTTCCATGTCTTCAGTGGACCAAGATATTACGCATTTGATCTTATTGCTCAGAGAGTTACCAGAGTTGCAAGAGGCAATAAATGGCTTAACTGTAGATATGGCTGAAGCAAAATCAAATGTGGCTGTATCCACTTTCAGAATGTTGAAGGGAAGTTCAGCAAGCATTTTCGTTACATTGTGTCCTGCTTATACTTTTCTCAATATTAAGTCATTGTTTCCCATCACTGTATCCATTCTACCTGTCCTCCGTGAAAATATGTTTGGAATATTCCACTATTTGCAGAGGCTTATTCAGTTCTTACACATTCCATCTTACATTAGTGATTCCATCAAAGAGAAGGAAAGTAAGCCTTTTTGTCACC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

human ... MMP8(4317)

Categorías relacionadas

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Alexandra Schubert-Unkmeir et al.
PLoS pathogens, 6(4), e1000874-e1000874 (2010-05-06)
Disruption of the blood-brain barrier (BBB) is a hallmark event in the pathophysiology of bacterial meningitis. Several inflammatory mediators, such as tumor necrosis factor alpha (TNF-alpha), nitric oxide and matrix metalloproteinases (MMPs), contribute to this disruption. Here we show that
Guanmei Wen et al.
The Journal of biological chemistry, 290(31), 19158-19172 (2015-06-21)
Matrix metalloproteinase-8 (MMP8) has been shown to influence various cellular functions. As monocytes and macrophages (Mφ) express MMP8, we investigated if MMP8 played a role in macrophage differentiation and polarization. MMP8 expression was significantly increased during monocyte differentiation into Mφ.
Muge Sarper et al.
Breast cancer research : BCR, 19(1), 33-33 (2017-03-24)
Normal myoepithelial cells (MECs) play an important tumour-suppressor role in the breast but display an altered phenotype in ductal carcinoma in situ (DCIS), gaining tumour-promoter functions. Matrix metalloproteinase-8 (MMP-8) is expressed by normal MECs but is lost in DCIS. This

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico