Saltar al contenido
Merck

EHU053481

MISSION® esiRNA

targeting human CDK9

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño

Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324

Documentos clave

Ver Toda la documentación
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TACGAGAAGCTCGCCAAGATCGGCCAAGGCACCTTCGGGGAGGTGTTCAAGGCCAGGCACCGCAAGACCGGCCAGAAGGTGGCTCTGAAGAAGGTGCTGATGGAAAACGAGAAGGAGGGGTTCCCCATTACAGCCTTGCGGGAGATCAAGATCCTTCAGCTTCTAAAACACGAGAATGTGGTCAACTTGATTGAGATTTGTCGAACCAAAGCTTCCCCCTATAACCGCTGCAAGGGTAGTATATACCTGGTGTTCGACTTCTGCGAGCATGACCTTGCTGGGCTGTTGAGCAATGTTTTGGTCAAGTTCACGCTGTCTGAGATCAAGAGGGTGATGCAGATGCTGCTTAACGGCCTCTACTACATCCACAGAAACAAGATCCTGCATAGGGACATGAAGGCTGCTAATGTGCTTATCACTCGTGATGGGGTCCTGAAGCTGGCAGACTTT

Ensembl | human accession no.

ENSG00000136807

NCBI accession no.

NM_001261

shipped in

ambient

storage temp.

−20°C

Quality Level

100

Gene Information

human ... CDK9(1025)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
TYU
JUU
ZPU
WMU
DPU

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Jinglu Wang et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(5), 5990-6000 (2019-02-07)
Despite surgical and chemotherapeutic advances over the past few decades, the prognosis for ovarian cancer remains very poor. Although cyclin-dependent kinase (CDK) 9 has an established pathogenic role in various cancers, its function in ovarian cancer remains poorly defined. The
Xiaoyang Li et al.
Journal of orthopaedic research : official publication of the Orthopaedic Research Society, 37(2), 510-521 (2018-11-30)
Synovial sarcomas hold a low genomic complexity, making it distinct from other types of soft-tissue sarcomas. Many studies focused on targeting the SS18-SSX fusion protein, which presents in over 90% of human synovial sarcomas. This protein acts as an oncogenic
Shasha He et al.
Oncology reports, 44(5), 1929-1938 (2020-09-10)
Endometrial cancer is one of the three major malignant tumors of the female reproductive system. Although cyclin‑dependent kinase 9 (CDK9) has a definitive pathogenic role in various types of cancer, little is known concerning its function in endometrial cancer. Our
Muhammed H Rahaman et al.
Molecular oncology, 13(10), 2178-2193 (2019-08-10)
Colorectal cancer (CRC) remains one of the most lethal human malignancies, and pursuit of new therapeutic targets for treatment has been a major research focus. Cyclin-dependent kinase 9 (CDK9), which plays a crucial role in transcription, has emerged as a
Nicole Pinto et al.
PloS one, 15(9), e0239315-e0239315 (2020-09-25)
Anaplastic thyroid cancer (ATC) is a rare, but nearly uniformly fatal disease that is typically resistant to chemotherapy and radiation. Alternative strategies to target this cancer at a molecular level are necessary in order to improve dismal outcomes for ATC
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico