Saltar al contenido
Merck

EHU059261

MISSION® esiRNA

targeting human TFEB

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño

Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324

Documentos clave

Ver Toda la documentación
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCGGCAGAAGAAAGACAATCACAACTTAATTGAAAGGAGACGAAGGTTCAACATCAATGACCGCATCAAGGAGTTGGGAATGCTGATCCCCAAGGCCAATGACCTGGACGTGCGCTGGAACAAGGGCACCATCCTCAAGGCCTCTGTGGATTACATCCGGAGGATGCAGAAGGACCTGCAAAAGTCCAGGGAGCTGGAGAACCACTCTCGCCGCCTGGAGATGACCAACAAGCAGCTCTGGCTCCGTATCCAGGAGCTGGAGATGCAGGCTCGAGTGCACGGCCTCCCTACCACCTCCCCGTCCGGCATGAACATGGCTGAGCTGGCCCAGCAGGTGGTGAAGCAGGAGCTGCCTAGCGAAGAGGGCCCAGGGGAGGCCCTGATGCTGGGGGCTGAGGTCCCTGACCCTGAGCCACTGCCAGCTCTGCCCCCGCAAGCCCCGCTGCCCCTGCCCACCCAGCCACCATCCCCATTCCATCACCTGGACTTCAGCCAC

Ensembl | human accession no.

ENSG00000112561

NCBI accession no.

NM_007162

shipped in

ambient

storage temp.

−20°C

Quality Level

100

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
DCV
PAV
PZU
FVU
MOU

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Sijie Tan et al.
Scientific reports, 9(1), 727-727 (2019-01-27)
Mitochondrial dysfunction underscores aging and diseases. Mitophagy (mitochondria + autophagy) is a quality control pathway that preserves mitochondrial health by targeting damaged mitochondria for autophagic degradation. Hence, molecules or compounds that can augment mitophagy are therapeutic candidates to mitigate mitochondrial-related diseases. However
Valeria Crippa et al.
Scientific reports, 6, 22827-22827 (2016-03-11)
Neurodegenerative diseases (NDs) are often associated with the presence of misfolded protein inclusions. The chaperone HSPB8 is upregulated in mice, the human brain and muscle structures affected during NDs progression. HSPB8 exerts a potent pro-degradative activity on several misfolded proteins
Samuel Peña-Llopis et al.
The EMBO journal, 30(16), 3242-3258 (2011-08-02)
Mammalian target of rapamycin (mTOR) complex 1 (mTORC1) is an important, highly conserved, regulator of cell growth. Ancient among the signals that regulate mTORC1 are nutrients. Amino acids direct mTORC1 to the surface of the late endosome/lysosome, where mTORC1 becomes
Li He et al.
Journal of leukocyte biology, 100(5), 1113-1124 (2016-11-02)
Macrophage dysfunction in obesity and diabetes is associated with persistent inflammation and poor wound healing responses. Relevant to these phenotypes, we have previously shown that macrophage activation in a high-fat environment results in cell death via a mechanism that involves
Xingchen Zhao et al.
The Journal of pathology, 245(2), 235-248 (2018-03-24)
Insufficient autophagy in podocytes is related to podocyte injury in diabetic nephropathy (DN). Advanced glycation end-products (AGEs) are major factors of podocyte injury in DN. However, the role and mechanism of AGEs in autophagic dysfunction remain unknown. We investigated autophagic
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico