Saltar al contenido
Merck

EHU065071

MISSION® esiRNA

targeting human ITGB1

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño

Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324

Documentos clave

Ver Toda la documentación
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle

Nombre del producto

MISSION® esiRNA, targeting human ITGB1

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGGGCTTTACGGAGGAAGTAGAGGTTATTCTTCAGTACATCTGTGAATGTGAATGCCAAAGCGAAGGCATCCCTGAAAGTCCCAAGTGTCATGAAGGAAATGGGACATTTGAGTGTGGCGCGTGCAGGTGCAATGAAGGGCGTGTTGGTAGACATTGTGAATGCAGCACAGATGAAGTTAACAGTGAAGACATGGATGCTTACTGCAGGAAAGAAAACAGTTCAGAAATCTGCAGTAACAATGGAGAGTGCGTCTGCGGACAGTGTGTTTGTAGGAAGAGGGATAATACAAATGAAATTTATTCTGGCAAATTCTGCGAGTGTGATAATTTCAACTGTGATAGATCCAATGGCTTAATTTGTGGAGGAAATGGTGTTTGCAAGTGTCGTGTGTGTGAGTGCAACCCCAACTACACTGGCAGTGCATGTGACTGTTCTTTGGATACTAGTACTTGTGAAGCCAGCAACG

Ensembl | human accession no.

ENSG00000150093

NCBI accession no.

NM_002211

shipped in

ambient

storage temp.

−20°C

Quality Level

100

Gene Information

human ... ITGB1(3688), ITGB1(3688)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
FDV
ACNV
LWU
VQU
POU

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Wenjie Yang et al.
Reproductive sciences (Thousand Oaks, Calif.), 27(1), 132-144 (2020-02-13)
This study aimed to investigate the regulatory mechanism of circular RNA CSPP1 (hsa_circ_CSPP1) in cervical cancer. Based on GEO database, differentially expressed circRNAs and mRNAs related to cervical cancer were screened out by R software. Kyoto Encyclopedia of Genes and
Kathleen Wantoch von Rekowski et al.
Biomolecules, 9(12) (2019-11-30)
Tumor cell binding to the microenvironment is regarded as the onset of therapeutic resistance, referred to as cell adhesion mediated drug resistance (CAM-DR). Here we elucidate whether CAM-DR occurs in ovarian cancer cells and contributes to still-existing cisplatin resistance. Cultivation
Cherine Abou Faycal et al.
British journal of cancer, 118(12), 1596-1608 (2018-05-26)
While lung adenocarcinoma patients can somewhat benefit from anti-angiogenic therapies, patients with squamous cell lung carcinoma (SQLC) cannot. The reasons for this discrepancy remain largely unknown. Soluble VEGF receptor-1, namely sVEGFR1-i13, is a truncated splice variant of the cell membrane-spanning
Asma Boudria et al.
Oncogene, 38(7), 1050-1066 (2018-09-09)
Vascular endothelial growth factor-A (VEGF-A) is highly subjected to alternative pre-mRNA splicing that generates several splice variants. The VEGFxxx and VEGFxxxb families encode splice variants of VEGF-A that differ only at the level of six amino acids in their C-terminal
Zahia Hamidouche et al.
BMC cell biology, 11, 44-44 (2010-06-25)
The potential of mesenchymal stromal cells (MSCs) to differentiate into functional bone forming cells provides an important tool for bone regeneration. The identification of factors that trigger osteoblast differentiation in MSCs is therefore critical to promote the osteogenic potential of
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico