Saltar al contenido
Merck

EHU082301

MISSION® esiRNA

targeting human OGT

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño

Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324

Documentos clave

Ver Toda la documentación
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle

Nombre del producto

MISSION® esiRNA, targeting human OGT

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAAAACTGCAGGAAGCTCTGATGCATTATAAGGAGGCTATTCGAATCAGTCCTACCTTTGCTGATGCCTACTCTAATATGGGAAACACTCTAAAGGAGATGCAGGATGTTCAGGGAGCCTTGCAGTGTTATACGCGTGCCATCCAAATTAATCCTGCATTTGCAGATGCACATAGCAATCTGGCTTCCATTCATAAGGATTCAGGGAATATTCCAGAAGCCATAGCTTCTTACCGCACGGCTCTGAAACTTAAGCCTGATTTTCCTGATGCTTATTGTAACTTGGCTCATTGCCTGCAGATTGTCTGTGATTGGACAGACTATGATGAGCGAATGAAGAAGTTGGTCAGTATTGTGGCTGACCAGTTAGAGAAGAATAGGTTGCCTTCTGTGCATCCTCATCA

Ensembl | human accession no.

ENSG00000147162

NCBI accession no.

NM_181673

shipped in

ambient

storage temp.

−20°C

Quality Level

100

Gene Information

human ... OGT(8473), OGT(8473)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
EDV
ABV
CZU
RKU
FHU

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Lan V Pham et al.
Oncotarget, 7(49), 80599-80611 (2016-10-08)
The hexosamine biosynthetic pathway (HBP) requires two key nutrients glucose and glutamine for O-linked N-acetylglucosamine (O-GlcNAc) cycling, a post-translational protein modification that adds GlcNAc to nuclear and cytoplasmic proteins. Increased GlcNAc has been linked to regulatory factors involved in cancer
Bing Zhang et al.
American journal of cancer research, 7(6), 1337-1349 (2017-07-04)
Abnormal cellular energetics has emerged as a hallmark of cancer cells. Deregulating aerobic glycolysis can alter multiple metabolic and signaling pathways in cancer cells, and trigger unlimited growth and proliferation. Accumulating evidence suggests that elevated levels of protein modification with
Ewa Forma et al.
PloS one, 13(6), e0198351-e0198351 (2018-06-05)
Enhancer of zest homolog 2 (EZH2) is a histone methyltransferase which plays a crucial role in cancer progression by regulation of genes involved in cellular processes such as proliferation, invasion and self-renewal. Activity and biological function of EZH2 are regulated
Juliana L Sacoman et al.
The Journal of biological chemistry, 292(11), 4499-4518 (2017-01-20)
O-Linked N-acetylglucosamine transferase (OGT) catalyzes O-GlcNAcylation of target proteins and regulates numerous biological processes. OGT is encoded by a single gene that yields nucleocytosolic and mitochondrial isoforms. To date, the role of the mitochondrial isoform of OGT (mOGT) remains largely
K M Kampa-Schittenhelm et al.
EBioMedicine, 54, 102678-102678 (2020-04-10)
Overriding the differentiation blockage in acute myeloid leukemia (AML) is the most successful mode-of-action in leukemia therapy - now curing the vast majority of patients with acute promyelocytic leukemia (APL) using all-trans retinoic acid (ATRA)-based regimens. Similar approaches in other
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico