Saltar al contenido
Merck

EHU085471

MISSION® esiRNA

targeting human SDC3

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño


Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACCCCAACTCCAGAGACCTTCCTGACCACAATCCGGGATGAGCCAGAGGTTCCGGTGAGTGGGGGGCCCAGTGGAGACTTCGAGCTGCCAGAAGAAGAGACCACACAACCAGACACAGCCAATGAGGTGGTAGCTGTGGGAGGGGCTGCGGCCAAGGCATCATCTCCACCTGGGACACTGCCCAAGGGTGCCCGCCCGGGCCCTGGCCTCCTGGACAATGCCATCGACTCGGGCAGCTCAGCTGCTCAGCTGCCTCAGAAGAGTATCCTGGAGCGGAAGGAGGTGCTCGTAGCTGTGATTGTGGGCGGGGTGGTGGGCGCCCTCTTTGCTGCCTTCTTGGTCACACTGCTCATCTATCGTATGAAGAAAAAGGATGAGGGCAGCTACACGCTGGAGGAACCCAAGCAGGCGAGCGTCACATACCAGAAGCCTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Anissa Kempf et al.
Developmental cell, 43(1), 24-34 (2017-09-26)
Heparan sulfate proteoglycans (HSPGs) critically modulate adhesion-, growth-, and migration-related processes. Here, we show that the transmembrane protein, Nogo-A, inhibits neurite outgrowth and cell spreading in neurons and Nogo-A-responsive cell lines via HSPGs. The extracellular, active 180 amino acid Nogo-A
Erik H Knelson et al.
The Journal of clinical investigation, 124(7), 3016-3031 (2014-06-18)
Neuroblastoma prognosis is dependent on both the differentiation state and stromal content of the tumor. Neuroblastoma tumor stroma is thought to suppress neuroblast growth via release of soluble differentiating factors. Here, we identified critical growth-limiting components of the differentiating stroma

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico