Saltar al contenido
Merck

EHU097101

MISSION® esiRNA

targeting human JAK3

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño


Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCCTCTCGGACAACATCTTCTCTCGCCAGTCAGACGTCTGGAGCTTCGGGGTCGTCCTGTACGAGCTCTTCACCTACTGCGACAAAAGCTGCAGCCCCTCGGCCGAGTTCCTGCGGATGATGGGATGTGAGCGGGATGTCCCCGCCCTCTGCCGCCTCTTGGAACTGCTGGAGGAGGGCCAGAGGCTGCCGGCGCCTCCTGCCTGCCCTGCTGAGGTGAGTTGCTACAGTGGCTGGAGAGACGACATCTGCTCCATGGGCTGGTGGCCGACAGTAATCTCACGCTGGGACCTGGCCTGCAGCCCCTGCCCCAGACCTCTCACCATCACC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

human ... JAK3(3718)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Jung Seok Kim et al.
International journal of nanomedicine, 13, 4817-4830 (2018-09-15)
Efficient target-specific siRNA delivery has always been a primary concern in the field of siRNA clinical application. In this study, four different types of anti-epidermal growth factor receptor (EGFR) antibody-conjugated immunonanoparticles were prepared and tested for cancer cell-targeted therapeutic siRNA
Longfei Pan et al.
Experimental biology and medicine (Maywood, N.J.), 245(15), 1395-1403 (2020-07-16)
Accumulating evidence suggests that vascular remodeling due to immoderate proliferation and migration of SMCs is a common process occurring in APE. In this work, we tried to find a breakthrough in the pathological mechanism to alleviate the prognosis of APE
Nina A Sibbesen et al.
Oncotarget, 6(24), 20555-20569 (2015-08-06)
Aberrant activation of Janus kinase-3 (Jak3) and its key down-stream effectors, Signal Transducer and Activator of Transcription-3 (STAT3) and STAT5, is a key feature of malignant transformation in cutaneous T-cell lymphoma (CTCL). However, it remains only partially understood how Jak3/STAT

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico