Saltar al contenido
Merck

EHU100781

MISSION® esiRNA

targeting human SREBF2

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño


Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATCGCTCCTCCATCAATGACAAAATCATCGAATTGAAAGACCTGGTCATGGGGACAGACGCCAAGATGCACAAGTCTGGCGTTCTGAGGAAGGCCATTGATTACATCAAATACTTGCAGCAGGTCAATCATAAACTGCGCCAGGAGAACATGGTGCTGAAGCTGGCAAATCAAAAGAACAAGCTTCTAAAGGGCATCGACCTAGGCAGTCTGGTGGACAATGAGGTGGACCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

human ... SREBF2(6721)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Johan Fernø et al.
BMC neuroscience, 7, 69-69 (2006-10-21)
The etiology of schizophrenia is unknown, but neurodevelopmental disturbances, myelin- and oligodendrocyte abnormalities and synaptic dysfunction have been suggested as pathophysiological factors in this severe psychiatric disorder. Cholesterol is an essential component of myelin and has proved important for synapse
Demin Cai et al.
Nature communications, 10(1), 4621-4621 (2019-10-13)
Tumor subtype-specific metabolic reprogrammers could serve as targets of therapeutic intervention. Here we show that triple-negative breast cancer (TNBC) exhibits a hyper-activated cholesterol-biosynthesis program that is strongly linked to nuclear receptor RORγ, compared to estrogen receptor-positive breast cancer. Genetic and
Silvia Cetrullo et al.
Cells, 9(3) (2020-03-01)
While high levels of saturated fatty acids are associated with impairment of cardiovascular functions, n-3 polyunsaturated fatty acids (PUFAs) have been shown to exert protective effects. However the molecular mechanisms underlying this evidence are not completely understood. In the present
Paul Lebeau et al.
The Journal of biological chemistry, 292(4), 1510-1523 (2016-12-03)
Accumulating evidence implicates endoplasmic reticulum (ER) stress as a mediator of impaired lipid metabolism, thereby contributing to fatty liver disease and atherosclerosis. Previous studies demonstrated that ER stress can activate the sterol regulatory element-binding protein-2 (SREBP2), an ER-localized transcription factor
Qingrong Li et al.
The Journal of toxicological sciences, 44(7), 481-491 (2019-07-05)
Bisphenol A (BPA), an environmental chemical to which humans are commonly exposed, has been shown to increase cholesterol level but the molecular mechanism is not clear. Since cholesterol biosynthesis plays an important role in elevating cholesterol level, the aim of

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico