Iniciar sesión para ver los precios por organización y contrato.
Seleccione un Tamaño
Cambiar Vistas
Acerca de este artículo
NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarledescription
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CTGAGTGTGATCCTGGTTGGCGAGAATCCTGCAAGTCACTCCTATGTCCTCAACAAAACCAGGGCAGCTGCAGTTGTGGGAATCAACAGTGAGACAATTATGAAACCAGCTTCAATTTCAGAGGAAGAATTGTTGAATTTAATCAATAAACTGAATAATGATGATAATGTAGATGGCCTCCTTGTTCAGTTGCCTCTTCCAGAGCATATTGATGAGAGAAGGATCTGCAATGCTGTTTCTCCAGACAAGGATGTTGATGGCTTTCATGTAATTAATGTAGGACGAATGTGTTTGGATCAGTATTCCATGTTACCGGCTACTCCATGGGGTGTGTGGGAAATAATCAAGCGAACTGGCATTCCAACCCTAGGGAAGAATGTGGTTGTGGCTGGAAGGTCAAAAAACGTTGGAATGCCCATTGCAATGTTACTGCACACAGATGGGG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... MTHFD2(10797)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Clase de almacenamiento
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Elija entre una de las versiones más recientes:
¿Ya tiene este producto?
Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.
Yueli Gu et al.
Oncology research, 25(7), 1069-1079 (2017-01-07)
Aberrant expression of microRNA-92a (miR-92a) has been investigated in various cancers. However, the function and mechanism of miR-92a in acute myeloid leukemia (AML) remain to be elucidated. Our data showed that miR-92a was evidently downregulated and methylenetetrahydrofolate dehydrogenase 2 (MTHFD2)
Vidhi Pareek et al.
Science (New York, N.Y.), 368(6488), 283-290 (2020-04-18)
Metabolons, multiprotein complexes consisting of sequential enzymes of a metabolic pathway, are proposed to be biosynthetic "hotspots" within the cell. However, experimental demonstration of their presence and functions has remained challenging. We used metabolomics and in situ three-dimensional submicrometer chemical