Saltar al contenido
Merck

EHU123581

MISSION® esiRNA

targeting human THPO

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño

Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324

Documentos clave

Ver Toda la documentación
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCTCAGACACTGCCGACATCAGCATTGTCTCGTGTACAGCTCCCTTCCCTGCAGGGCGCCCCTGGGAGACAACTGGACAAGATTTCCTACTTTCTCCTGAAACCCAAAGCCCTGGTAAAAGGGATACACAGGACTGAAAAGGGAATCATTTTTCACTGTACATTATAAACCTTCAGAAGCTATTTTTTTAAGCTATCAGCAATACTCATCAGAGCAGCTAGCTCTTTGGTCTATTTTCTGCAGAAATTTGCAACTCACTGATTCTCTACATGCTCTTTTTCTGTGATAACTCTGCAAAGGCCTGGGCTGGCCTGGCAGTTGAACAGAGGGAGAGACTAACCTTGAGTCAGAAAACAGAGAAAGGGTAATTTCCTTTGCTTCAAATTCAAGGCCTTCCAACGCCCCCATCCCCTTTACTATCATTCTCAGTGGGACTCTGATCCC

Ensembl | human accession no.

ENSG00000090534

NCBI accession no.

NM_000460

shipped in

ambient

storage temp.

−20°C

Quality Level

100

Gene Information

human ... THPO(7066)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Ting Zou et al.
Cancer biomarkers : section A of Disease markers, 25(2), 133-139 (2018-11-20)
Long noncoding RNAs (LncRNAs) are involved in the occurrence and progression of human tumors including ovarian cancer (OC). Long noncoding RNA HOTTIP has been found to be involved in several human tumors development. However, the role of HOTTIP in OC
Bo-Wen Dai et al.
Journal of Cancer, 10(19), 4540-4551 (2019-09-19)
As a master regulator of embryonic morphogenesis, homeodomain-containing gene 10 (HOXC10) has been found to promote progression of human cancers and indicate poor survival outcome. Therefore, we concentrate on elucidating the role of HOXC10 in progression of oral squamous cell
Bo Li et al.
Free radical research, 52(4), 390-401 (2018-02-06)
Substantial evidence indicates that the alteration of the cellular redox status is a critical factor involved in cell growth and death and results in tumourigenesis. Cancer cells have an efficient antioxidant system to counteract the increased generation of ROS. However
Hideo Otsuki et al.
The Prostate, 77(2), 222-233 (2016-10-04)
Leucine stimulates cancer cell proliferation through the mTOR pathway, therefore, inhibiting leucine transporters may be a novel therapeutic target for cancer. L-type amino acid transporter (LAT) 1, a Na LNCaP and DU145 and PC-3 cell lines were used as a
Jie Zhang et al.
Disease markers, 2019, 8964015-8964015 (2019-11-30)
Cyclin-dependent kinase regulatory subunit 2 (CKS2) is a member of the cell cycle-dependent protein kinase subunit family, which is implicated as an oncogene in various malignancies. However, the clinical significance, oncogenic functions, and related mechanisms of CKS2 in hepatocellular carcinoma
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico