EHU129271
MISSION® esiRNA
targeting human DDX5
Iniciar sesión para ver los precios por organización y contrato.
Seleccione un Tamaño
Cambiar Vistas
Acerca de este artículo
NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarledescription
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CAGCTTGCTGAAGATTTCCTGAAAGACTATATTCATATAAACATTGGTGCACTTGAACTGAGTGCAAACCACAACATTCTTCAGATTGTGGATGTGTGTCATGACGTAGAAAAGGATGAAAAACTTATTCGTCTAATGGAAGAGATCATGAGTGAGAAGGAGAATAAAACCATTGTTTTTGTGGAAACCAAAAGAAGATGTGATGAGCTTACCAGAAAAATGAGGAGAGATGGGTGGCCTGCCATGGGTATCCATGGTGACAAGAGTCAACAAGAGCGTGACTGGGTTCTAAATGAATTCAAACATGGAAAAGCTCCTATTCTGATTGCTACAGATGTGGCCTCCAGAGGGCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCTAACTCCTCAGAGGATTATATTCATCGAATTGGAAGAACTGCTCGC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... DDX5(1655)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Clase de almacenamiento
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Elija entre una de las versiones más recientes:
¿Ya tiene este producto?
Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.
Nazia Abbasi et al.
Life science alliance, 3(10) (2020-08-21)
Tumorigenesis in different segments of the intestinal tract involves tissue-specific oncogenic drivers. In the colon, complement component 3 (C3) activation is a major contributor to inflammation and malignancies. By contrast, tumorigenesis in the small intestine involves fatty acid-binding protein 1
Hao Zhang et al.
Hepatology (Baltimore, Md.), 69(3), 1046-1063 (2018-10-04)
In hepatocellular carcinoma (HCC), dysregulated expression of DDX5 (DEAD box protein 5) and impaired autophagy have been reported separately. However, the relationship between them has not been explored. Here we present evidence to show that, by interacting with autophagic receptor
Yeon J Lee et al.
Genes & development, 32(15-16), 1060-1074 (2018-07-26)
Alternative premessenger RNA (pre-mRNA) splicing is a post-transcriptional mechanism for controlling gene expression. Splicing patterns are determined by both RNA-binding proteins and nuclear pre-mRNA structure. Here, we analyzed pre-mRNA splicing patterns, RNA-binding sites, and RNA structures near these binding sites