Saltar al contenido
Merck

EHU149771

MISSION® esiRNA

targeting human T

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño

Cambiar Vistas

Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCGTCTCCTTCAGCAAAGTCAAGCTCACCAACAAGCTCAACGGAGGGGGCCAGATCATGCTGAACTCCTTGCATAAGTATGAGCCTCGAATCCACATAGTGAGAGTTGGGGGTCCACAGCGCATGATCACCAGCCACTGCTTCCCTGAGACCCAGTTCATAGCGGTGACTGCTTATCAGAACGAGGAGATCACAGCTCTTAAAATTAAGTACAATCCATTTGCAAAAGCTTTCCTTGATGCAAAGGAAAGAAGTGATCACAAAGAGATGATGGAGGAACCCGGAGACAGCCAGCAACCTGGGTACTCCCAATGGGGGTGGCTTCTTCCTGGAACCAGCACCCTGTGTCCACCTGCAAATCCTCATCCTCAGTTTGGAGGTGCCCTCTCCCTCCCCTCCACGCACAGCTGTGACAGGTACCCAACCCTGAGGAGCCACCGGTCCTCACCCTACCCCAGCCCCTATGCTCATCGGAACAATTCTCCAACCTATTCTGACAACTCACCTGCATGTTTATCCATGCTGCAATCCCATGACAATTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... T(6862)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos



Zewen Kelvin Tuong et al.
PloS one, 11(1), e0147179-e0147179 (2016-01-27)
Nuclear hormone receptors have important roles in the regulation of metabolic and inflammatory pathways. The retinoid-related orphan receptor alpha (Rorα)-deficient staggerer (sg/sg) mice display several phenotypes indicative of aberrant lipid metabolism, including dyslipidemia, and increased susceptibility to atherosclerosis. In this
Yi-Hui Yu et al.
International journal of clinical and experimental pathology, 8(3), 2582-2589 (2015-06-06)
The aim of this study was to determine whether long non-coding RNA PVT1 can participate in the regulation of cardiac hypertrophy. A C57BL/6 mouse cardiac hypertrophic model was established using transverse aortic constriction (TAC). The animals subjected to sham operation
Jiaxuan Chen et al.
Journal of tissue engineering and regenerative medicine, 10(1), 40-51 (2013-06-21)
1α,25-Dihydroxyvitamin D3 [1α,25(OH)2D3] and bone morphogenetic protein-2 (BMP2) are both used to stimulate osteoblastic differentiation. 1α,25(OH)2D3 regulates osteoblasts through classical steroid hormone receptor mechanisms and through rapid responses that are mediated by two receptors, the traditional vitamin D receptor (VDR)