Saltar al contenido
Merck

EHU157051

MISSION® esiRNA

targeting human MCM10

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño

Cambiar Vistas

Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTTCAAGCTGCTGGAGACCTGCGTCAGTGAGCAGCATGAATACCACTGGCATGATGGTGTGAAGAGGTTTTTCAAATGTCCCTGTGGAAACAGAAGCATCTCCTTGGACAGACTCCCGAACAAGCACTGCAGTAACTGTGGCCTCTACAAATGGGAACGGGACGGAATGCTAAAGGAAAAGACTGGTCCAAAGATAGGAGGAGAAACTCTGTTACCAAGAGGAGAAGAACATGCTAAATTTCTGAACAGCCTTAAATAACCCGAACTTCAGACATTTTCCCACAGACTTCCTGGCCTCCTGTGACTCTGGAAAGCAAAGGATTGGCTGTGTATTGTCCATTGATTCCTGATTGACGCCGTCAAAAACAAATGCTTGTTAAGCCCATAAGCTTTGCCTGCTTACTTTCTGCCATTGGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... MCM10(55388)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos



Peng Kang et al.
Journal of molecular neuroscience : MN, 70(5), 759-768 (2020-02-08)
Minichromosome maintenance 10 (MCM10) plays an important role in DNA replication and is expressed in a variety of tumors, including glioma. However, its role and mechanism in glioma remain elusive. The purpose of this study was to examine the molecular
Feilun Cui et al.
The Prostate, 78(16), 1299-1310 (2018-08-11)
Prostate cancer (PCa) is one of the most malignant tumors of the male urogenital system. There is an urgent need to identify novel biomarkers for PCa. In this study, we evaluated the expression levels of MCM10 in prostate cancer by
Wei-Dong Yang et al.
Journal of biochemical and molecular toxicology, 33(7), e22330-e22330 (2019-04-17)
The minichromosome maintenance protein 10 (MCM10) is one of the MCM proteins that initiate DNA replication by interacting with CDC45-MCM2-7. It has been reported that MCM10 has a role in breast cancer progression. However, MCM10 in breast cancer is still not comprehensively