Saltar al contenido
Merck

EHU157091

MISSION® esiRNA

targeting human GRIN1

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño


Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle

Nombre del producto

MISSION® esiRNA, targeting human GRIN1

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATCAACGGCAAGAACGAGTCGGCCCACATCAGCGACGCCGTGGGCGTGGTGGCCCAGGCCGTGCACGAGCTCCTCGAGAAGGAGAACATCACCGACCCGCCGCGGGGCTGCGTGGGCAACACCAACATCTGGAAGACCGGGCCGCTCTTCAAGAGAGTGCTGATGTCTTCCAAGTATGCGGATGGGGTGACTGGTCGCGTGGAGTTCAATGAGGATGGGGACCGGAAGTTCGCCAACTACAGCATCATGAACCTGCAGAACCGCAAGCTGGTGCAAGTGGGCATCTACAATGGCACCCACGTCATCCCTAATGACAGGAAGATCATCTGGCCAGGCGGAGAGACAGAGAAGCCTCGAGGGTACCAGATGTCCACCAGACTGAAGATTGTGACGATCCACCAGGAGCCCTTCGTGTACGTCAAGCCCACGCTGAGTGATGGGACATGCAAGGAGGAGTTCACAGTCAACGGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

James I Hearn et al.
Thrombosis and haemostasis, 120(4), 671-686 (2020-04-15)
The release of calcium ions (Ca2+) from the endoplasmic reticulum (ER) and related store-operated calcium entry (SOCE) regulate maturation of normal megakaryocytes. The N-methyl-D-aspartate (NMDA) receptor (NMDAR) provides an additional mechanism for Ca2+ influx in megakaryocytic cells, but its role
Takashi Miyamoto et al.
The Journal of biological chemistry, 291(4), 1719-1734 (2015-11-22)
Diverse lines of evidence suggest that amyloid-β (Aβ) peptides causally contribute to the pathogenesis of Alzheimer disease (AD), the most frequent neurodegenerative disorder. However, the mechanisms by which Aβ impairs neuronal functions remain to be fully elucidated. Previous studies showed

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico