Saltar al contenido
Merck

EMU020501

MISSION® esiRNA

targeting mouse Bag3

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño


Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle

product line

MISSION®

description

Powered by Eupheria Biotech

form

lyophilized powder

esiRNA cDNA target sequence

AGCAATTGATGTCCCAGGTCAAGTACAAGTCTATGAACTCCAGCCCAGCAACCTTGAGGCCGAGCAGCCACTCCAGGAAATCATGGGTGCCGTGGTAGCCGACAAGGATGAGAAAGGTCCTGAAAACAAAGATCCACAAACTGAAAGCCAACAGCTAGAAGCCAAAGCAGCCACACCTCCAAATCCCAGCAACCCAGCAGACTCAGCTGGCAACCTGGTGGCTCCCTAGTGTCCCCTGGGACCATGCTGTAGAGACTTTTAAGTTGCATGCACTGCGGGACTTGCAGTCAGCTGGCTGCCATTATTCATAGCCACTTGGTATGCAGTAACTTGGGGTGGAGGTAAAACACTAACAAAGGGGGCTTTTCTTCCATAGTCTATTCTGTATAAATAATAAGTTGCCTGTTCCAGAAGTCTAACCCTAACCCCTCTGGTTGTCTGG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Georg Karpel-Massler et al.
Oncotarget, 6(16), 14507-14521 (2015-05-27)
Despite great efforts taken to advance therapeutic measures for patients with glioblastoma, the clinical prognosis remains grim. The antiapoptotic Bcl-2 family protein Mcl-1 is overexpressed in glioblastoma and represents an important resistance factor to the BH-3 mimetic ABT263. In this
Georg Karpel-Massler et al.
Oncotarget, 6(34), 36456-36471 (2015-10-17)
Glioblastoma is the most frequent primary brain tumor in adults. Current therapeutic options are sparse and the prognosis of patients suffering from this disease is grim. Abundance in intratumoral heterogeneity among different deregulated signaling pathways is a hallmark of glioblastoma
Young-Hee Jin et al.
Biochemical and biophysical research communications, 464(2), 561-567 (2015-07-15)
Bcl2-associated athoanogene (BAG) 3 is a member of the co-chaperone BAG family. It is induced by stressful stimuli such as heat shock and heavy metals, and it regulates cellular adaptive responses against stressful conditions. In this study, we identified a

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico