Saltar al contenido
Merck

EMU031541

MISSION® esiRNA

targeting mouse Pmaip1

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño


Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AACTCCGGAGGATTGGAGACAAAGTGAATTTACGGCAGAAACTTCTGAATTTGATTTCCAAGCTCTTCAATTTAGTAACCTGAGTTCTTCCAAAGCTTTTGCAAGAAGGGACCTCCCAGGAAGGAAGTTCCGCCGGTTGATGGAAATGCCTGGTATTGGATGGATTGTGATGTGATGAGAGAAACGCTCGCTTGCTTTTGGTTCCCTGAGCAGGGATGATGAAGGAGATAGGAATGAGTTTCTTTCGGAAAGTTTTCAGAAATCGTTCTTTGAGCTGTGATAACGTGAAACCACACTTGTTTTTACTTTTATTATTATTTTTTTGAAGAGTCGTGGAGCTAGGGAAGTAACTAGTAATAATCTATCTTTTTAGAGTTGTTCTGGTTGTTTTTGCCAAAGGTTGTTGTCAAGAATAATAGACGGGGTATGGCTAGTGGTTACATTGTATGGGGGCAGTCGTTTGGGATTGCTTT

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Wei Qian et al.
Oncotarget, 5(12), 4180-4194 (2014-06-24)
Overcoming platinum drug resistance represents a major clinical challenge in cancer treatment. We discovered a novel drug combination using cisplatin and a class of thioquinazolinone derivatives including mdivi-1 (mitochondrial division inhibitor-1), that induces synergistic apoptosis in platinum resistant tumor cells
Georg Karpel-Massler et al.
Oncotarget, 6(34), 36456-36471 (2015-10-17)
Glioblastoma is the most frequent primary brain tumor in adults. Current therapeutic options are sparse and the prognosis of patients suffering from this disease is grim. Abundance in intratumoral heterogeneity among different deregulated signaling pathways is a hallmark of glioblastoma
Xiao-Lan Li et al.
Oncotarget, 6(34), 36689-36699 (2015-10-10)
PRIMA-1met (APR-246) is a methylated derivative and structural analog of PRIMA-1 (p53 re-activation and induction of massive apoptosis). PRIMA-1met has been reported to restore both the wild type (wt) structure and function of mutant p53. Here, we show that PRIMA-1met
Haichao Zhang et al.
Molecular cancer, 14, 126-126 (2015-07-03)
Defects in programmed cell death, or apoptosis, are a hallmark of cancer. The anti-apoptotic B-cell lymphoma 2 (BCL-2) family proteins, including BCL-2, BCL-X(L), and MCL-1 have been characterized as key survival factors in multiple cancer types. Because cancer types with
Florian Engert et al.
Molecular cancer therapeutics, 14(12), 2818-2830 (2015-10-07)
Ewing sarcoma has recently been reported to be sensitive to poly(ADP)-ribose polymerase (PARP) inhibitors. Searching for synergistic drug combinations, we tested several PARP inhibitors (talazoparib, niraparib, olaparib, veliparib) together with chemotherapeutics. Here, we report that PARP inhibitors synergize with temozolomide

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico