Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TGAGGTGGAAAACCTCATCCTACACAAGGACTACAGCGCTGACACGCTTGCTCACCACAACGACATTGCCTTGCTGAAGATCCGTTCCAAGGAGGGCAGGTGTGCGCAGCCATCCCGGACTATACAGACCATCTGCCTGCCCTCGATGTATAACGATCCCCAGTTTGGCACAAGCTGTGAGATCACTGGCTTTGGAAAAGAGAATTCTACCGACTATCTCTATCCGGAGCAGCTGAAAATGACTGTTGTGAAGCTGATTTCCCACCGGGAGTGTCAGCAGCCCCACTACTACGGCTCTGAAGTCACCACCAAAATGCTGTGTGCTGCTGACCCACAGTGGAAAACAGATTCCTGCCAGGGAGACTCAGGGGGACCCCTCGTCTGTTCCCTCCAAGGCCGCATGACTTTGACTGGAATTGTGAGCTGG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... PLAU(5328)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Related Content
Instructions
Xin Zhao et al.
European journal of pharmacology, 880, 173225-173225 (2020-05-29)
Tripterygium wilfordii Hook F (TwHF) exhibits anti-tumor efficacy in pancreatic ductal adenocarcinoma (PDAC), however the pharmacological mechanisms are unclear due to complicated formulae and target genes. Using Traditional Chinese Medicine Systems Pharmacology and GeneCards databases, we performed a network pharmacology
Anuradha Moirangthem et al.
Scientific reports, 6, 21903-21903 (2016-02-26)
In cancer progression, proteolytic enzymes like serine proteases and metalloproteinases degrade the basement membrane enabling the tumor cells to invade the adjacent tissues. Thus, invasion and metastasis are augmented by these enzymes. Simultaneous silencing of uPA and MMP9 in breast
Peng Liu et al.
Scientific reports, 6, 37606-37606 (2016-11-22)
Pancreatic cancer is a highly metastatic and chemo-resistant disease. Secreted proteins involved in cell-cell interactions play an important role in changing the tumor microenvironment. Previous studies generally focus on the secretome of cancer cell line from serum-free media, due to