Skip to Content
Merck

EHU016511

MISSION® esiRNA

targeting human CHN1

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCCAGACTTGAAGCATGTCAAAAAGGTGTACAGCTGTGACCTTACGACGCTCGTGAAAGCACATACCACTAAGCGGCCAATGGTGGTAGACATGTGCATCAGGGAGATTGAGTCTAGAGGTCTTAATTCTGAAGGACTATACCGAGTATCAGGATTTAGTGACCTAATTGAAGATGTCAAGATGGCTTTCGACAGAGATGGTGAGAAGGCAGATATTTCTGTGAACATGTATGAAGATATCAACATTATCACTGGTGCACTTAAACTGTACTTCAGGGATTTGCCAATTCCACTCATTACATATGATGCCTACCCTAAGTTTATAGAATCTGCCAAAATTATGGATCCGGATGAGCAATTGGAAACCCTTCATGAAGCACTGAAACTACTGCCACCTGCTCACTGCGAAACCCTCCGGTACCTCAT

Ensembl | human accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... CHN1(1123)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library


Related Content

Instructions


Yujia Yue et al.
Tissue engineering. Part A, 23(21-22), 1241-1250 (2017-05-05)
Endothelial progenitor cell (EPC)-based therapy has immense potential to promote cardiac neovascularization and attenuate ischemic injury. Functional benefits of EPCs and other adult stem cell therapies largely involve paracrine mechanisms and exosomes secreted by stem cells are emerging as pivotal
Danni Wang et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 40(3-4), 644-656 (2016-11-30)
Microarray screening had found BRAF-activated non-coding RNA (BANCR) was significantly upregulated in type 1 endometrial cancer (EC). This study aimed to assess the potential role of long non-coding RNA (lncRNA) BANCR in the pathogenesis and progression of type 1 EC.
Lei Wu et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 84, 1029-1035 (2016-10-22)
Due to the low cost and favorable safety profile, valproic acid (VPA) has been considered as a potential candidate drug for therapy of various cancers. Our present study revealed that VPA, at the concentration (1mM) which has no effect on