Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TGCTGCCACTGTTTGCTTACTTCATCCGAGACTGGCGGATGCTGCTGGTGGCGCTGACGATGCCGGGGGTGCTATGCGTGGCACTCTGGTGGTTCATCCCTGAGTCCCCCCGATGGCTCATCTCTCAGGGACGATTTGAAGAGGCAGAGGTGATCATCCGCAAGGCTGCCAAAGCCAATGGGATTGTTGTGCCTTCCACTATCTTTGACCCGAGTGAGTTACAAGACCTAAGTTCCAAGAAGCAGCAGTCCCACAACATTCTGGATCTGCTTCGAACCTGGAATATCCGGATGGTCACCATCATGTCCATAATGCTGTGGATGACCATATCAGTGGGCTATTTTGGGCTTTCGCTTGATACTCCTAACTTGCATGGGGACATCTTTGTGAACTGCTTCCTTTCAGCGATGGTTGAAGTCCCAGCAT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... SLC22A5(6584)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Related Content
Instructions
Kei Higuchi et al.
Drug metabolism and pharmacokinetics, 30(2), 182-187 (2015-04-11)
Memantine is clinically used for the treatment of patients with Alzheimer's disease and is highly distributed to the brain. The aim of this study is to characterize memantine transport at the blood-brain barrier (BBB) using hCMEC/D3 cells, a human BBB
Mitsuko Akaihata et al.
Molecular and cellular biochemistry, 459(1-2), 49-59 (2019-05-18)
Glucocorticoid (GC) resistance is associated with poor response to the following chemotherapy in lymphoid malignancies, such as lymphoma and leukemia. However, it remains unclear whether GCs interfere with the cytotoxic effects of anti-cancer drugs on GC-resistant cells. In this study
Jiaojiao Cong et al.
Journal of ethnopharmacology, 252, 112581-112581 (2020-01-23)
The herbs of Aconitum are the essential Traditional Chinese medicine and have played an indispensable role in many Asian countries for thousands of years to treat critical illnesses, and chronic, stubborn diseases. However, Aconitum may induce severe neurotoxicity and even