Skip to Content
Merck

EHU022711

MISSION® esiRNA

targeting human PRICKLE1

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAAAGCCTCTTTCAGCCACAGCCCAATGAGATGGATATTCGAGCCAGTGAGCACTGGATATCTGATAACATGGTTAAAAGTAAGACCGAGTTAAAGCAAAATAACCAGAGCCTTGCAAGTAAAAAATACCAGTCTGATATGTACTGGGCACAGTCACAAGATGGACTGGGCGATTCTGCTTATGGCAGCCACCCAGGCCCTGCAAGCAGTAGAAGGCTTCAGGAATTGGAACTGGACCATGGGGCTTCAGGGTATAATCATGATGAAACACAGTGGTATGAAGATTCCCTGGAGTGTCTGTCAGACCTGAAACCAGAGCAAAGTGTTCGGGATTCGATGGATTCTTTGGCATTGTCCAATATCACAGGGGCTTCGGTGGATGGAGAAAACAAGCCAAGGCCATCATTGTATTCTCTGCAAAATTTTGAGGAGATGGAAACAGAAGATTGTGAGAAGATGAGCAATATGGGAACTTTGAACTCTTCCATGCTGCAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... PRICKLE1(144165)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Danielle E Johnson et al.
The Journal of cell biology, 212(6), 677-692 (2016-03-16)
We examined the luminal pH of individual lysosomes using quantitative ratiometric fluorescence microscopy and report an unappreciated heterogeneity: peripheral lysosomes are less acidic than juxtanuclear ones despite their comparable buffering capacity. An increased passive (leak) permeability to protons, together with
Maika S Deffieu et al.
Science advances, 7(2) (2021-02-02)
The biosynthetic secretory pathway is particularly challenging to investigate as it is underrepresented compared to the abundance of the other intracellular trafficking routes. Here, we combined the retention using selective hook (RUSH) to a CRISPR-Cas9 gene editing approach (eRUSH) and
Noopur V Khobrekar et al.
Developmental cell, 53(2), 141-153 (2020-04-11)
Autophagy plays critical roles in neurodegeneration and development, but how this pathway is organized and regulated in neurons remains poorly understood. Here, we find that the dynein adaptor RILP is essential for retrograde transport of neuronal autophagosomes, and surprisingly, their