Skip to Content
Merck

EHU026721

MISSION® esiRNA

targeting human PAK2

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACCCTTTGTCAGCCAATCACAGTTTGAAACCTTTGCCCTCTGTTCCAGAAGAGAAAAAGCCCAGGCATAAAATCATCTCCATATTCTCAGGCACAGAGAAAGGAAGTAAAAAGAAAGAAAAGGAACGGCCAGAAATTTCTCCTCCATCTGATTTTGAGCACACCATCCATGTTGGCTTTGATGCTGTTACTGGAGAATTCACTGGCATGCCAGAACAGTGGGCTCGATTACTACAGACCTCCAATATCACCAAACTAGAGCAAAAGAAGAATCCTCAGGCTGTGCTGGATGTCCTAAAGTTCTACGACTCCAACACAGTGAAGCAGAAATATCTGAGCTTTACTCCTCCTGAGAAAGATGGCTTTCCTTCTGGAACACCAGCACTGAATGCCAAGGGAACAGAAGCACCCGCAGTAGT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... PAK2(5062)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Ting Shuang et al.
FEBS letters, 589(20 Pt B), 3154-3164 (2015-09-13)
MiR-134 has been reported to have a role in the development and progression of various cancers. In this study, we found that miR-134 expression was significantly decreased in chemo-resistant serous epithelial ovarian cancer (EOC) patients. Over-expression of miR-134 enhanced the
Elizabeth Flate et al.
International journal of oncology, 45(4), 1401-1411 (2014-07-23)
The interaction between tumor cells and extracellular matrix (ECM) proteins influences cell migration and the invasive behavior of cancer cells. In this study, we provide experimental evidence that collagen I and fibronectin affect ovarian cancer cell migration. In vitro wound healing assays
Anna E Dart et al.
The Journal of cell biology, 211(4), 863-879 (2015-11-26)
P21-activated kinase 4 (PAK4) is a Cdc42 effector protein thought to regulate cell adhesion disassembly in a kinase-dependent manner. We found that PAK4 expression is significantly higher in high-grade human breast cancer patient samples, whereas depletion of PAK4 modifies cell