Skip to Content
Merck

EHU034191

MISSION® esiRNA

targeting human S100A9

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAGCTGGAACGCAACATAGAGACCATCATCAACACCTTCCACCAATACTCTGTGAAGCTGGGGCACCCAGACACCCTGAACCAGGGGGAATTCAAAGAGCTGGTGCGAAAAGATCTGCAAAATTTTCTCAAGAAGGAGAATAAGAATGAAAAGGTCATAGAACACATCATGGAGGACCTGGACACAAATGCAGACAAGCAGCTGAGCTTCGAGGAGTTCATCATGCTGATGGCGAGGCTAACCTGGGCCTCCCACGAGAAGATGCACGAGGGTGACGAGGGCCCTGGCCACCACCATAAGCCAGGCCTCGGGGAGGGCACCCCCTAAGACCACAGTGGCCAAGATCACAGTGGCCACGGCCACGGCCACAGTCATGGTGGCCACGGCCACAGCCACTAATCAGGAGGCCAGGCCACCCTGCCTCTACCCAACCAGGGCCCCGGGGCCTGTTATGTCAAACTGTCTTGGCTGTGG

Ensembl | human accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... S100A9(6280)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Yiwen Zhou et al.
Frontiers in pharmacology, 12, 640521-640521 (2021-04-02)
Hepatic macrophages play a critical role in inflammation caused by alcohol feeding. During this process, variation of macrophage phenotypes triggers inflammatory responses in a variety of ways. Moreover, there is increasing evidence that Brain and Muscle Arnt-Like Protein-1 (Bmal1) is
Liang Peng et al.
Frontiers in cellular and infection microbiology, 10, 47-47 (2020-03-03)
Bacterial infection remains one of the leading causes of death worldwide due to the continuous rise of multiple antibiotic-resistant bacteria. Focusing solely on bacteria as the drug targets is a major limitation inherent in the conventional antibiotic therapy. Recently, host-directed
Ping Wu et al.
Oncology research, 25(9), 1479-1488 (2017-03-10)
Hypopharyngeal cancer (HPC) frequently presents at an advanced stage and displays early submucosal spread, resulting in a poor prognosis. It is among the worst of all cancers in the head and neck subsites. Therefore, detection of HPC at an earlier