Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GTGGCTACAGCAAAGCATCAAAAATGTGATGGACGATTCCATTAATAATAGATTAAATAATACATTTTCCTATGTAACTCATGAAGACATCTGTAATTGCTTTAATGGTGATACACTTTTGGCCATTCAGGCACCTTCTGGTACACAACTGGAGGTACCCATTCCAGAAATGGGTCAGAATGGACAAAAGAAATACCAGATCAATCTAAAGAGTCATTCAGGACCTATCCATGTGCTGCTTATAAATAAAGAGTCGAGTTCATCTAAGCCCGTGGTTTTTCCTGTTCCCCCACCTGATGACCTCACACAGCCTTCCTCCCAGTCCTTGACTCCAGTGACTCCACAGAAATCCAGCATGGCAACTCAAAATCTGCCTGAGCAACATGTCTCTGAAAGAAGCCAGGCTCTG
Ensembl | human accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... E2F5(1875)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Ying Liu et al.
Biochemical and biophysical research communications, 511(1), 35-40 (2019-02-16)
The MYCN oncoprotein induces the proliferation of neuroblastoma cells through regulating gene transcription. The E2F transcription factor 5 (E2F5) plays an oncogenic role in several types of cancer, however, its role in neuroblastoma cells remains poorly characterized. We report here
Yoshinori Inagaki et al.
Oncology reports, 44(5), 2241-2252 (2020-10-02)
E2F transcription factor 5 (E2F5) is a member of the E2F family of transcription factors, which are involved in regulation of various cellular processes, including cellular proliferation, apoptosis, differentiation and DNA damage response. Previously, we reported that E2F5 was aberrantly
Xiupeng Xu et al.
American journal of cancer research, 7(8), 1680-1692 (2017-09-02)
Glioblastoma multiforme (GBM) is an extraordinary aggressive disease that requires more effective therapeutic options. In the past few years, many microRNAs (miRNAs) have been demonstrated to have important roles in promoting GBM progression. However, little is known about the role