Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
ATGACCTGGCCAAGTTGAAGGTGGCAATCAAATACCACCAGAAAGAGTTTGTTGCTCAGCCCAACTGCCAACAGTTGCTTGCCACCCTGTGGTATGATGGCTTCCCTGGATGGCGGCGGAAACACTGGGTAGTCAAGCTTCTAACCTGCATGACCATTGGGTTCCTGTTTCCCATGCTGTCTATAGCCTACCTGATCTCACCCAGGAGCAACCTTGGGCTGTTCATCAAGAAACCCTTTATCAAGTTTATCTGCCACACAGCATCCTATTTGACCTTCCTCTTTATGCTTCTCCTGGCTTCTCAGCACATTGTCAGGACAGACCTTCATGTACAGGGGCCTCCCCCAACTGTCGTGGAATGGATGATATTGCCTTGGGTTCTAGGTTTCATTTGGGGTGAGATTAAGGAAATGTGGGATGGTGGATTTACTGAATACATCCATGACTGGTGGAACCTGATGGATTT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... TRPC5(7224)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Yan Zou et al.
Oncology reports, 41(6), 3413-3423 (2019-04-04)
Temozolomide (TMZ) is the first choice chemotherapy agent against glioblastoma, but the TMZ chemotherapy resistance has restricted the clinical application. Although autophagy is considered an adaptive response for cell survival under the pressure of chemotherapy and associated with chemotherapy resistance
Kayaho Maeda et al.
The Journal of clinical investigation, 128(8), 3445-3459 (2018-07-10)
Podocyte malfunction occurs in autoimmune and nonautoimmune kidney disease. Calcium signaling is essential for podocyte injury, but the role of Ca2+/calmodulin-dependent kinase (CaMK) signaling in podocytes has not been fully explored. We report that podocytes from patients with lupus nephritis
Peng Zhang et al.
Scientific reports, 7(1), 3158-3158 (2017-06-11)
Adriamycin is a first-line chemotherapy agent against cancer, but the development of resistance has become a major problem. Although autophagy is considered to be an adaptive survival response in response to chemotherapy and may be associated with chemoresistance, its inducer