Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
AGCGTGGTGGACAAACTTCTGTATGCTGTGGAACCTTTCCACCAGGGCCACCATTCTGTGGACACAGCAGCCATGGCAGGCTTGGCATTCACCTGTCTGAAGCGCTCAAACTTCAACCCTGGTCGGAGACAACGGATCACCATGGCCATCAGAACAGTGCGAGAGGAGATCTTGAAGGCCCAGACCCCCGAGGGCCACTTTGGGAATGTCTACAGCACCCCATTGGCATTACAGTTCCTCATGACTTCCCCCATGCGTGGGGCAGAACTGGGAACAGCATGTCTCAAGGCGAGGGTTGCTTTGCTGGCCAGTCTGCAGGATGGAGCCTTCCAGAATGCTCTCATGATTTCCCAGCTGCTGCCCGTTCTGAACCACAAGACCTACATTGATCTGATCTTCCCAGACTGTCTGGCACCACGAGTCATGTTGGAACCAGCTGCTGAGACCATTCCTCAGACCCA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... TCN2(6948)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Caitlin J Bowen et al.
Developmental biology, 407(1), 145-157 (2015-07-19)
Proper remodeling of the endocardial cushions into thin fibrous valves is essential for gestational progression and long-term function. This process involves dynamic interactions between resident cells and their local environment, much of which is not understood. In this study, we
Tomas Baldassarre et al.
Molecular cancer research : MCR, 13(6), 1044-1055 (2015-03-19)
Triple-negative breast cancers (TNBCs) are highly aggressive cancers that lack targeted therapies. However, EGFR is frequently activated in a subset of TNBCs and represents a viable clinical target. Because the endocytic adaptor protein Endophilin A2 (SH3GL1/Endo II) has been implicated
Zheren Shao et al.
PloS one, 10(7), e0132655-e0132655 (2015-07-24)
Melanomas cause over 76% of skin cancer deaths annually. Phosphatidylinositol 3-kinase (PI3K)-AKT-mammalian target of rapamycin (mTOR) signaling pathway is important for melanoma initiation and progression. In the current study, we evaluated the potential anti-melanoma effect of VS-5584, a novel and