Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GAAAATCTTTCCCCCACCTCTTCCCAAATGATTCAGCAGTCTCATGATAATCCAAGTAACTCTCTGTGTGAAGCACCTTTGAACATTTCACGTGATACTTTGTGTTCAGATGAATACTTTGCTGGTGGCTTACACTCATCTTTTGATGATCTTTGTGGAAACTCAGGATGTGGAAATCAGGAAAGGAAGTTGGAAGGATCCATTAATGACATTAAAAGTGATGTGTGTATTTCTTCACTTGTATTGAAAGCAAATAATATTCATTCATCACCATCTTTCACTCACCTCGATAAATCAAGTCCTCAGAAATTTCTGAGTAATCTTTCAAAGGAAGAAATAAACTTGCAAAGAAATATTGCAGGTAAAGTAGTCACCCCTGACCAAAAGCAGGCTGCAGGTATGT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... MCPH1(79648)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
María Arroyo et al.
Genes, 11(4) (2020-04-12)
The capacity of Topoisomerase II (Topo II) to remove DNA catenations that arise after replication is essential to ensure faithful chromosome segregation. Topo II activity is monitored during G2 by a specific checkpoint pathway that delays entry into mitosis until
Alessandro Cicconi et al.
Nature communications, 11(1), 5861-5861 (2020-11-19)
Telomeres protect chromosome ends from inappropriately activating the DNA damage and repair responses. Primary microcephaly is a key clinical feature of several human telomere disorder syndromes, but how microcephaly is linked to dysfunctional telomeres is not known. Here, we show
Chunxiao Yan et al.
International journal of clinical and experimental pathology, 8(3), 2710-2718 (2015-06-06)
This study was designed to investigate the role of MCT1 in the development of cisplatin-resistant ovarian cancer and its possible relationship with Fas. We found the expression of MCT1 was obviously increased both in cisplatin-resistant ovarian cancer tissue and A2780/CP