Skip to Content
Merck

EHU047601

MISSION® esiRNA

targeting human MCPH1

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAAAATCTTTCCCCCACCTCTTCCCAAATGATTCAGCAGTCTCATGATAATCCAAGTAACTCTCTGTGTGAAGCACCTTTGAACATTTCACGTGATACTTTGTGTTCAGATGAATACTTTGCTGGTGGCTTACACTCATCTTTTGATGATCTTTGTGGAAACTCAGGATGTGGAAATCAGGAAAGGAAGTTGGAAGGATCCATTAATGACATTAAAAGTGATGTGTGTATTTCTTCACTTGTATTGAAAGCAAATAATATTCATTCATCACCATCTTTCACTCACCTCGATAAATCAAGTCCTCAGAAATTTCTGAGTAATCTTTCAAAGGAAGAAATAAACTTGCAAAGAAATATTGCAGGTAAAGTAGTCACCCCTGACCAAAAGCAGGCTGCAGGTATGT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... MCPH1(79648)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



María Arroyo et al.
Genes, 11(4) (2020-04-12)
The capacity of Topoisomerase II (Topo II) to remove DNA catenations that arise after replication is essential to ensure faithful chromosome segregation. Topo II activity is monitored during G2 by a specific checkpoint pathway that delays entry into mitosis until
Alessandro Cicconi et al.
Nature communications, 11(1), 5861-5861 (2020-11-19)
Telomeres protect chromosome ends from inappropriately activating the DNA damage and repair responses. Primary microcephaly is a key clinical feature of several human telomere disorder syndromes, but how microcephaly is linked to dysfunctional telomeres is not known. Here, we show
Chunxiao Yan et al.
International journal of clinical and experimental pathology, 8(3), 2710-2718 (2015-06-06)
This study was designed to investigate the role of MCT1 in the development of cisplatin-resistant ovarian cancer and its possible relationship with Fas. We found the expression of MCT1 was obviously increased both in cisplatin-resistant ovarian cancer tissue and A2780/CP