Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TTTGACAAGACTCGCACAGGAGAATTGATTAACCGCCTCTCATCAGACACTGCACTCCTGGGGCGCTCAGTGACTGAAAACCTCTCAGATGGGCTCAGGGCCGGGGCCCAGGCTTCCGTAGGCATCAGTATGATGTTTTTTGTCTCACCTAATCTGGCCACCTTTGTTTTGAGCGTGGTGCCTCCAGTGTCAATCATTGCTGTAATTTATGGGCGATATCTACGGAAACTGACCAAAGTCACTCAGGATTCCCTGGCACAAGCCACTCAGCTAGCTGAGGAACGTATTGGAAATGTAAGAACTGTTCGAGCTTTTGGGAAAGAAATGACTGAAATCGAGAAATATGCCAGCAAAGTGGACCATGTAATGCAGTTAGCAAGGAAAGAGGCATTCGCCCGGGCTGGTTTCTTTGGAGCAACTGGGCTCTCCGGAAACCTGATCGTGCTTTCTGTCCTG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... ABCB10(23456)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Xuefang Lin et al.
Molecular medicine reports, 23(5) (2021-03-25)
Circular RNA ABCB10 (circ‑ABCB10) modulates cellular functions and microRNA (miR)‑1271 in epithelial ovarian cancer (EOC). The present study aimed to investigate the interaction between circ‑ABCB10 and miR‑1271 in regulating EOC cellular function and the calpain small subunit 1 (Capn4)/Wnt/β‑catenin signaling pathway.
W-Q Zhang et al.
European review for medical and pharmacological sciences, 24(11), 6088-6096 (2020-06-24)
Circ-ABCB10 is a non-coding RNA newly discovered in recent years. It has been observed to serve as an oncogene in a variety of tumors, but its biological function in esophageal squamous cell carcinoma (ESCC) is still unknown. The purpose of
Yan Chen et al.
Cancer biomarkers : section A of Disease markers, 26(2), 151-161 (2019-08-06)
This study aimed to explore the correlation of circular RNA ABCB10 (circ-ABCB10) expression with clinicopathological features and survival, as well as its impact on regulating cell proliferation and apoptosis in epithelial ovarian cancer (EOC). A total of 103 EOC patients