Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CGAGGCACATTCACCATTAGTACCACTCTCCGGCTGGGTAGACAGATTTTGGAGTCTATTGAAAGCATTCATTCTGTGGGATTCTTGCATCGAGACATCAAACCGTCGAACTTCGCTATGGGTCGCTTTCCTAGTACATGTAGGAAATGTTACATGCTTGATTTTGGCTTGGCTCGACAATTTACCAATTCCTGTGGTGACGTCAGACCACCTCGAGCTGTGGCAGGTTTTCGAGGGACAGTTCGTTATGCATCAATCAACGCACATCGGAACAGGGAAATGGGAAGACATGATGACCTTTGGTCCTTATTCTACATGTTGGTGGAGTTTGTGGTTGGTCAGCTGCCCTGGAGAAAAATAAAGGACAAGGAGCAAGTAGGCTCTATTAAGGAGAGATATGACCACAGGCTCATGTTGAA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... TTBK2(146057)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Mi-Young Lee et al.
Cell division, 9, 3-3 (2014-10-04)
Centrosome amplification (CA) amongst particular breast cancer subtypes (Her2+ subtype) is associated with genomic instability and aggressive tumor phenotypes. However, changes in signaling pathways associated with centrosome biology have not been fully explored in subtype specific models. Novel centrosome regulatory
Xing Liu et al.
Oncotarget, 6(33), 34309-34320 (2015-09-30)
Hepatocellular carcinoma (HCC) is one of the most malignant cancers with poor clinical outcome. The protein kinase human monopolar spindle 1 (hMps1/TTK) gene expression is significantly increased in HCCs. However, its contributions to hepatocarcinogenesis remain unclear. In this study, we
Takashi Watanabe et al.
The Journal of cell biology, 210(5), 737-751 (2015-09-02)
Microtubules (MTs) play critical roles in various cellular events, including cell migration. End-binding proteins (EBs) accumulate at the ends of growing MTs and regulate MT end dynamics by recruiting other plus end-tracking proteins (+TIPs). However, how EBs contribute to MT