Skip to Content
Merck

EHU062331

MISSION® esiRNA

targeting human TRAF3IP2

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCAGAAGAATTGCGGAAAGTCTTTATCACTTATTCGATGGACACAGCTATGGAGGTGGTGAAATTCGTGAACTTTTTGTTGGTAAATGGCTTCCAAACTGCAATTGACATATTTGAGGATAGAATCCGAGGCATTGATATCATTAAATGGATGGAGCGCTACCTTAGGGATAAGACCGTGATGATAATCGTAGCAATCAGCCCCAAATACAAACAGGACGTGGAAGGCGCTGAGTCGCAGCTGGACGAGGATGAGCATGGCTTACATACTAAGTACATTCATCGAATGATGCAGATTGAGTTCATAAAACAAGGAAGCATGAATTTCAGATTCATCCCTGTGCTCTTCCCAAATGCTAAGAAGGAGCATGTGCCCACCTGGCTTCAGAACACTCATGTCTACAGCTGGCCCAAGAAT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... TRAF3IP2(10758)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Nitin A Das et al.
Journal of molecular and cellular cardiology, 121, 107-123 (2018-07-10)
Persistent inflammation promotes development and progression of heart failure (HF). TWEAK (TNF-Related WEAK Inducer Of Apoptosis), a NF-κB- and/or AP-1-responsive proinflammatory cytokine that signals via TWEAK receptor (TWEAKR), is expressed at high levels in human and preclinical models of HF.
Hongxue Sun et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 48(2), 528-539 (2018-07-19)
This study investigated the role of the microRNA miR-298 and its target Act1 in ischemic stroke. Cell viability was assessed with the 3-(4,5-dimethythiazol-2- yl)-2,5-diphenyl tetrazolium bromide assay. Apoptotic cells were detected by flow cytometry, and mRNA and protein expression were
Hyo Jeong Kim et al.
Biochemical and biophysical research communications, 524(4), 1044-1050 (2020-02-19)
Bone homeostasis is maintained by concerted actions of bone-forming osteoblasts and bone-resorbing osteoclasts. A wide range of evidence indicates that a proinflammatory cytokine IL-17 promotes osteoclastogenesis. However, the role of IL-17 in osteoblasts is less well-understood. In the current study