Skip to Content
Merck

EHU062411

MISSION® esiRNA

targeting human TRAF2

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTTGGAGCAGAAGGTCTTGGAGATGGAGGCATCCACCTACGATGGGGTCTTCATCTGGAAGATCTCAGACTTCGCCAGGAAGCGCCAGGAAGCTGTGGCTGGCCGCATACCCGCCATCTTCTCCCCAGCCTTCTACACCAGCAGGTACGGCTACAAGATGTGTCTGCGTATCTACCTGAACGGCGACGGCACCGGGCGAGGAACACACCTGTCCCTCTTCTTTGTGGTGATGAAGGGCCCGAATGACGCCCTGCTGCGGTGGCCCTTCAACCAGAAGGTGACCTTAATGCTGCTCGACCAGAATAACCGGGAGCACGTGATTGACGCCTTCAGGCCCGACGTGACTTCATCCTCTTTTCAGAGGCCAGTCAACGACATGAACATCGCAAGCGGCTGCCCCCTCTTCTGCCCCGTCTCCAAGATGGAGGCAAAGAATTCCTACGTGCGGGACGATGCCATCTTCATCAAGGCCATT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... TRAF2(7186)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Hong Cheng et al.
The Journal of investigative dermatology, 135(10), 2427-2436 (2015-05-29)
Previously, tumor necrosis factor (TNF)-like weak inducer of apoptosis (TWEAK) had been known to be an inducer of apoptosis of keratinocytes by engaging the Fn14 receptor. However, the high-risk human papillomavirus (HPV) infection confers a proliferation advantage on keratinocytes that
I Karl et al.
Cell death & disease, 5, e1444-e1444 (2014-10-10)
The relevance of the adaptor protein TNF receptor-associated factor 2 (TRAF2) for signal transduction of the death receptor tumour necrosis factor receptor1 (TNFR1) is well-established. The role of TRAF2 for signalling by CD95 and the TNF-related apoptosis inducing ligand (TRAIL)
Alexey V Sorokin et al.
Cancer research, 75(9), 1846-1858 (2015-04-17)
The protein tyrosine phosphatase receptor PTPRN2 is expressed predominantly in endocrine and neuronal cells, where it functions in exocytosis. We found that its immature isoform proPTPRN2 is overexpressed in various cancers, including breast cancer. High proPTPRN2 expression was associated strongly