Skip to Content
Merck

EHU064911

MISSION® esiRNA

targeting human CUL4B

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCAGGCAACTGGAATAGAGGATGGAGAGTTAAGGAGAACACTGCAGTCATTAGCCTGTGGCAAAGCTAGAGTTCTGGCGAAAAATCCAAAGGGCAAAGACATTGAAGATGGTGACAAGTTCATTTGTAATGATGATTTCAAACATAAACTTTTCAGGATAAAGATCAATCAAATCCAGATGAAAGAAACGGTTGAAGAACAAGCAAGCACTACAGAAAGAGTATTTCAAGACAGACAGTATCAAATTGATGCTGCAATTGTTCGAATTATGAAGATGAGAAAGACACTTAGCCACAATCTCCTTGTTTCAGAAGTGTACAACCAGTTGAAATTTCCAGTAAAGCCTGCTGATCTTAAGAAGAGAATAGAATCTTTAATTGACCGGGACTACATGGAAAGAGATAAAGAAAATCCAAACCAGTACAACTATATTGCATAGAATGTTGGCCTTGCAGCATTTGGTGTCAT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... CUL4B(8450)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Anbarasu Kumaraswamy et al.
The Journal of biological chemistry, 293(40), 15691-15705 (2018-08-25)
c-Myc is a proto-oncogene controlling expression of multiple genes involved in cell growth and differentiation. Although the functional role of c-Myc as a transcriptional regulator has been intensively studied, targeting this protein in cancer remains a challenge. Here, we report
Mingfeng Zhao et al.
The Prostate, 79(5), 480-488 (2019-01-05)
Cullin 4B (CUL4B), a scaffold protein that assembles CRL4B ubiquitin ligase complexes, is overexpressed in many types of solid tumors and contributes to epigenetic silencing of tumor suppressors. However, its clinical significance and underlying molecular mechanisms in prostate cancer (PCa)
Ye Lin et al.
Epigenetics & chromatin, 12(1), 22-22 (2019-04-18)
Neural tube defects (NTDs) are common birth defects involving the central nervous system. Recent studies on the etiology of human NTDs have raised the possibility that epigenetic regulation could be involved in determining susceptibility to them. Here, we show that