Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GCAGGCAACTGGAATAGAGGATGGAGAGTTAAGGAGAACACTGCAGTCATTAGCCTGTGGCAAAGCTAGAGTTCTGGCGAAAAATCCAAAGGGCAAAGACATTGAAGATGGTGACAAGTTCATTTGTAATGATGATTTCAAACATAAACTTTTCAGGATAAAGATCAATCAAATCCAGATGAAAGAAACGGTTGAAGAACAAGCAAGCACTACAGAAAGAGTATTTCAAGACAGACAGTATCAAATTGATGCTGCAATTGTTCGAATTATGAAGATGAGAAAGACACTTAGCCACAATCTCCTTGTTTCAGAAGTGTACAACCAGTTGAAATTTCCAGTAAAGCCTGCTGATCTTAAGAAGAGAATAGAATCTTTAATTGACCGGGACTACATGGAAAGAGATAAAGAAAATCCAAACCAGTACAACTATATTGCATAGAATGTTGGCCTTGCAGCATTTGGTGTCAT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... CUL4B(8450)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Anbarasu Kumaraswamy et al.
The Journal of biological chemistry, 293(40), 15691-15705 (2018-08-25)
c-Myc is a proto-oncogene controlling expression of multiple genes involved in cell growth and differentiation. Although the functional role of c-Myc as a transcriptional regulator has been intensively studied, targeting this protein in cancer remains a challenge. Here, we report
Mingfeng Zhao et al.
The Prostate, 79(5), 480-488 (2019-01-05)
Cullin 4B (CUL4B), a scaffold protein that assembles CRL4B ubiquitin ligase complexes, is overexpressed in many types of solid tumors and contributes to epigenetic silencing of tumor suppressors. However, its clinical significance and underlying molecular mechanisms in prostate cancer (PCa)
Ye Lin et al.
Epigenetics & chromatin, 12(1), 22-22 (2019-04-18)
Neural tube defects (NTDs) are common birth defects involving the central nervous system. Recent studies on the etiology of human NTDs have raised the possibility that epigenetic regulation could be involved in determining susceptibility to them. Here, we show that