Skip to Content
Merck

EHU066521

MISSION® esiRNA

targeting human SEMA4D

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTTTACGTGTGTGGGACCAACGCATTCCAGCCGGCCTGTGACCACCTGAACTTAACATCCTTTAAGTTTCTGGGGAAAAATGAAGATGGCAAAGGAAGATGTCCCTTTGACCCAGCACACAGCTACACATCCGTCATGGTTGATGGAGAACTTTATTCGGGGACGTCGTATAATTTTTTGGGAAGTGAACCCATCATCTCCCGAAATTCTTCCCACAGTCCTCTGAGGACAGAATATGCAATCCCTTGGCTGAACGAGCCTAGTTTCGTGTTTGCTGACGTGATCCGAAAAAGCCCAGACAGCCCCGACGGCGAGGATGACAGGGTCTACTTCTTCTTCACGGAGGTGTCTGTGGAGTATGAGTTTGTGTTCAGGGTGCTGATCCCACGGATAGCAAGAGTGTGCAAGGGGGAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... SEMA4D(10507)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Nicole Heitzig et al.
Cell adhesion & migration, 11(3), 275-287 (2017-01-07)
The physiological and pathological process of angiogenesis relies on orchestrated endothelial cell (EC) adhesion, migration and formation of new vessels. Here we report that human umbilical vein endothelial cells (HUVECs) deficient in Annexin A8 (AnxA8), a member of the annexin
Golnaz Rashidi et al.
Molecular biology reports, 47(9), 7017-7027 (2020-09-06)
Overexpression of semaphorin 4D (SEMA4D), an immune semaphorin, is found in various human malignancies, including colorectal cancer (CRC). In this study, we explored the relationship between silencing SEMA4D expression and 5-fluorouracil (5-FU) response in the colorectal cancer cell line. SW48
Katharina Lueck et al.
Scientific reports, 7(1), 4638-4638 (2017-07-07)
The retinoic acid derivative fenretinide (FR) is capable of transdifferentiating cultured retinal pigment epithelial (RPE) cells towards a neuronal-like phenotype, but the underlying mechanisms are not understood. To identify genes involved in this process we performed a microarray analysis of