Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CGCTTCACGGAAGAGTACCAGCTCTTCGAGGAATTGGGCAAGGGAGCCTTCTCGGTGGTGCGAAGGTGTGTGAAGGTGCTGGCTGGCCAGGAGTATGCTGCCAAGATCATCAACACAAAGAAGCTGTCAGCCAGAGACCATCAGAAGCTGGAGCGTGAAGCCCGCATCTGCCGCCTGCTGAAGCACCCCAACATCGTCCGACTACATGACAGCATCTCAGAGGAGGGACACCACTACCTGATCTTCGACCTGGTCACTGGTGGGGAACTGTTTGAAGATATCGTGGCCCGGGAGTATTACAGTGAGGCGGATGCCAGTCACTGTATCCAGCAGATCCTGGAGGCTGTGCTGCACTGCCACCAGATGGGGGTGGTGCACCGGGACCTGAAGCCTGAGAATCTGTTGCTGGCCTC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... CAMK2A(815)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Yamin Wei et al.
Neurochemical research, 44(7), 1613-1620 (2019-03-29)
Ischemic stroke is a leading cause of mortality and morbidity worldwide, and oxidative stress plays a significant role in the ischemia stage and reperfusion stage. Previous studies have indicated that both calcium/calmodulin-dependent protein kinase II (CaMKII) and glucose 6-phosphate dehydrogenase
Wenwei Liang et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 42(1), 383-396 (2017-05-31)
Periodic mechanical stress can promote chondrocyte proliferation and matrix synthesis to improve the quality of tissue-engineered cartilage. Although the integrin β1-ERK1/2 signal cascade has been implicated in periodic mechanical stress-induced mitogenic effects in chondrocytes, the precise mechanisms have not been
Lingheng Kong et al.
European journal of pharmacology, 886, 173539-173539 (2020-09-13)
Ca2+/calmodulin-dependent protein kinase II δ (CaMKIIδ) has been shown to play a vital role in pathological events in myocardial ischemia/reperfusion (IR) injury. Dysregulation of autophagy in cardiomyocytes is implicated in myocardial IR injury. Here, we examined whether CaMKIIδ inhibition could