Skip to Content
Merck

EHU070231

MISSION® esiRNA

targeting human SLC7A11

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATCTTTGTTGCCCTCTCCTGCTTTGGCTCCATGAACGGTGGTGTGTTTGCTGTCTCCAGGTTATTCTATGTTGCGTCTCGAGAGGGTCACCTTCCAGAAATCCTCTCCATGATTCATGTCCGCAAGCACACTCCTCTACCAGCTGTTATTGTTTTGCACCCTTTGACAATGATAATGCTCTTCTCTGGAGACCTCGACAGTCTTTTGAATTTCCTCAGTTTTGCCAGGTGGCTTTTTATTGGGCTGGCAGTTGCTGGGCTGATTTATCTTCGATACAAATGCCCAGATATGCATCGTCCTTTCAAGGTGCCACTGTTCATCCCAGCTTTGTTTTCCTTCACATGCCTCTTCATGGTTGCCCTTTCCCTCTATTCGGACCCATTTAGTACAGGGATTGGCTTCGTCATCACT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... SLC7A11(23657)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Naisu Yang et al.
Journal of genetics, 97(2), 463-468 (2018-06-23)
Solute carrier family 7 member 11 (SLC7A11) is a cystine/glutamate exchanger, also known as xCT, has been found to play an important role in pheomelanin synthesis. Adjusting the cystine content of cells to influence pheomelanin synthesis affects the proportion of
Masaki Nagane et al.
PloS one, 13(4), e0195151-e0195151 (2018-04-13)
The sodium-independent cystine-glutamate antiporter plays an important role in extracellular cystine uptake. It comprises the transmembrane protein, xCT and its chaperone, CD98. Because glutathione is only weakly cell membrane permeable, cellular uptake of its precursor, cystine, is known to be
Chun Ge et al.
Scientific reports, 7(1), 3791-3791 (2017-06-21)
Adriamycin (ADR) induces the over-expression of P-glycoprotein (P-gp) and multiple drug resistance in breast cancer cells. However, the biochemical process and underlying mechanisms are not clear. Our previous study revealed that ADR increased reactive oxygen species (ROS) generation and decreased