Skip to Content
Merck

EHU077571

MISSION® esiRNA

targeting human BSG

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCTGGTCACCATCATCTTCATCTACGAGAAGCGCCGGAAGCCCGAGGACGTCCTGGATGATGACGACGCCGGCTCTGCACCCCTGAAGAGCAGCGGGCAGCACCAGAATGACAAAGGCAAGAACGTCCGCCAGAGGAACTCTTCCTGAGGCAGGTGGCCCGAGGACGCTCCCTGCTCCACGTCTGCGCCGCCGCCGGAGTCCACTCCCAGTGCTTGCAAGATTCCAAGTTCTCACCTCTTAAAGAAAACCCACCCCGTAGATTCCCATCATACACTTCCTTCTTTTTTAAAAAAGTTGGGTTTTCTCCATTCAGGATTCTGTTCCTTAGGTTTTTTTCCTTCTGAAGTGTTTCACGAGAGCCCGGGAGCTGCTGCCCTGCGGCCCCGTCTGTGGCTTTCAGCCTCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... BSG(682)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Tomoki Yoshioka et al.
The American journal of pathology, 189(7), 1338-1350 (2019-04-25)
Podocytes, which are susceptible to injury by various stimuli and stress, are critical regulators of proteinuric kidney diseases, regardless of the primary disease and pathogenesis. We further confirmed a significant correlation between urinary CD147/basigin (Bsg) levels and proteinuria in patients
Yao Meng et al.
Frontiers in cell and developmental biology, 8, 543856-543856 (2020-11-17)
Cancer stem cells (CSCs), responsible for cancer metastasis and recurrence, are generated from non-CSCs after chemo-radiation therapy. This study investigated the induction of CSC potential in non-stem breast cancer cells and the underlying molecular mechanisms in detachment culture. Bulk breast
Chaoqun Wang et al.
The American journal of pathology, 188(7), 1597-1607 (2018-04-10)
Epithelial-to-mesenchymal transition (EMT) is postulated to be a prerequisite for the establishment of endometriosis (EMS), a common reproductive disorder in women. Our previous studies have demonstrated the elevated expression of transmembrane glycoprotein CD147 and its prosurvival effect on abnormal cells