Skip to Content
Merck

EHU077611

MISSION® esiRNA

targeting human VAV3

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGAGTGGAGTCAGCCATCTCTAGTTTAGACTACATTTCTAAGACAAAAGAAGATGTCAAACTGAAATTAGAGGAATGTTCCAAAAGAGCAAATAATGGGAAATTTACTCTTCGAGACTTGCTTGTGGTTCCTATGCAACGTGTTTTAAAGTACCACCTTCTCCTCCAGGAACTGGTCAAACATACCACTGATCCGACTGAGAAGGCAAATCTGAAACTGGCTCTTGATGCCATGAAGGACTTGGCACAATATGTGAATGAAGTGAAAAGAGATAATGAGACCCTTCGTGAAATTAAACAGTTTCAGCTATCTATAGAGAATTTGAACCAACCAGTTTTGCTTTTTGGACGACCTCAGGGAGATGGTGAAATTCGAATAACCACTCTAGACAAGCATACCAAACAAGAAAGGCATATCTTCTTATTTGATTTGGCAGTGATCGT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... VAV3(10451)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Jie Sha et al.
Endocrinology and metabolism (Seoul, Korea), 29(3), 363-370 (2014-10-14)
The role of small GTPase molecules is poorly understood under high glucose conditions. We analyzed the expression pattern of Vav3 in skeletal muscle C2C12 cells under high glucose culture condition with reverse transcription-polymerase chain reaction and Western blot analysis. We
Takeo Nomura et al.
Molecular cancer, 12, 27-27 (2013-04-10)
The Vav family of Rho/Rac guanosine nucleotide exchange factors comprises three members in mammalian cells. Vav3 enhances androgen receptor (AR) activity during progression to androgen independence in prostate cancer. We examined Vav3 small interfering RNA (siRNA) effects on cell proliferation
J K Liu et al.
Cell death and differentiation, 21(8), 1325-1339 (2014-05-17)
Glioblastoma is the most common primary intrinsic brain tumor and remains incurable despite maximal therapy. Glioblastomas display cellular hierarchies with self-renewing glioma-initiating cells (GICs) at the apex. To discover new GIC targets, we used in vivo delivery of phage display