Skip to Content
Merck

EHU079871

MISSION® esiRNA

targeting human TEAD1

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCTTTATTTCTAGTGACCCAATATGCATATTAACCTGCTATAACTAGGGCTATATGTGTAGGTATGTGTATACATATACACAAATGCACATATAGAGTTAACACATTTAGTGAACACTTGTTTAGTGTCACTCAGTTTGCTAGGTGCTGATATGTACGTATATCTCAATGTGTCTGTAGACTTAGATACATCCTCTTGAAGCACATCCATTTCTTTAGCGTCTCTCAGTAAGTTACAGTACTTGTTTGACTTAGGTTTAAGAGGCCCAGCTACCTATCTCTGACCTTTTCAAATAGGCTCATTTGGGAGATTCTTTTGCCAGGAGAGATTCAACTTTCCAATCTAAGTATTCCAGAGCATTGCCCAGGCAGAGTTGGTTTGATGTGGCCAGATGTTTTGAGTTATTTCCCTTAAGTGTTTCACTGGGGAGAGAACAGGGAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... TEAD1(7003)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Min-Hao Yu et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 83, 496-501 (2016-10-25)
Colorectal cancer (CRC) is the most common type of gastrointestinal cancer. However, up to date, the specific mechanism for CRC proliferation remains unclear. Transcriptional enhancer activator domain 1 (TEAD1) is a transcription factor belongs to the TEAD family, which plays
Shi Jiao et al.
Nature communications, 8, 14058-14058 (2017-01-05)
Concerted co-regulation of multiple signalling pathways is crucial for tissue homoeostasis and tumorigenesis. Here we report that VGLL4, a previously identified YAP antagonist, also functions as a regulator of Wnt/β-catenin signalling. The expression of VGLL4 is significantly downregulated in clinical
Claudia Stein et al.
PLoS genetics, 11(8), e1005465-e1005465 (2015-08-22)
YAP1 is a major effector of the Hippo pathway and a well-established oncogene. Elevated YAP1 activity due to mutations in Hippo pathway components or YAP1 amplification is observed in several types of human cancers. Here we investigated its genomic binding