Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GGCACTAACGTGGGAGAAACTGCCAAGCAAGTTCAAGAAGTTCTATGCGGAGTTTGAAAGTTTAATGGACCCTTCAAGGAACCACAGGGCCTACAGGCTGACAGTAGCTAAGCTGGAACCTCCTCTCATCCCCTTCATGCCTTTGCTCATTAAAGATATGACATTTACTCATGAGGGGAACAAGACGTTCATTGACAATCTAGTAAACTTTGAAAAAATGCGCATGATTGCAAATACGGCCAGAACAGTGAGATACTACAGGAGCCAACCCTTCAATCCTGATGCAGCTCAAGCTAATAAGAACCATCAGGATGTCCGGAGTTATGTACGGCAATTAAATGTGATTGACAACCAGAGAACTTTATCACAGATGTCACACAGATTAGAGCCTCGTCGACCATAGA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... RAPGEF4(11069)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Kazuya Kusama et al.
Reproduction, fertility, and development (2018-05-08)
Protein kinase A (PKA) signalling accompanies elevated intracellular cAMP levels during endometrial stromal cell (ESC) decidualisation. Exchange protein directly activated by cAMP (EPAC), an alternate mediator of cAMP signalling, promotes PKA analogue-induced decidualisation; however, the precise mechanism by which EPAC
Wei Sun et al.
Biochemical and biophysical research communications, 485(2), 355-359 (2017-02-22)
Cyclic adenosine 3'-5'-monophosphate (cAMP) plays a crucial role in regulating pituitary cell proliferation and hormone synthesis. Recent evidence suggests that exchange proteins directly activated by cAMP (Epacs) may mediate the effects of cAMP. Here we used rat anterior pituitary GH3
Kazuya Kusama et al.
Reproduction (Cambridge, England), 147(6), 897-906 (2014-03-04)
The optimal decidualization of endometrial stromal cells (ESCs) following embryo implantation is one of the critical steps to establish pregnancy in rodents and humans. This step is intricately regulated by ovarian hormones. Using in vitro human ESCs model, we previously