Skip to Content
Merck

EHU080731

MISSION® esiRNA

targeting human RAPGEF4

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGCACTAACGTGGGAGAAACTGCCAAGCAAGTTCAAGAAGTTCTATGCGGAGTTTGAAAGTTTAATGGACCCTTCAAGGAACCACAGGGCCTACAGGCTGACAGTAGCTAAGCTGGAACCTCCTCTCATCCCCTTCATGCCTTTGCTCATTAAAGATATGACATTTACTCATGAGGGGAACAAGACGTTCATTGACAATCTAGTAAACTTTGAAAAAATGCGCATGATTGCAAATACGGCCAGAACAGTGAGATACTACAGGAGCCAACCCTTCAATCCTGATGCAGCTCAAGCTAATAAGAACCATCAGGATGTCCGGAGTTATGTACGGCAATTAAATGTGATTGACAACCAGAGAACTTTATCACAGATGTCACACAGATTAGAGCCTCGTCGACCATAGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... RAPGEF4(11069)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Kazuya Kusama et al.
Reproduction, fertility, and development (2018-05-08)
Protein kinase A (PKA) signalling accompanies elevated intracellular cAMP levels during endometrial stromal cell (ESC) decidualisation. Exchange protein directly activated by cAMP (EPAC), an alternate mediator of cAMP signalling, promotes PKA analogue-induced decidualisation; however, the precise mechanism by which EPAC
Wei Sun et al.
Biochemical and biophysical research communications, 485(2), 355-359 (2017-02-22)
Cyclic adenosine 3'-5'-monophosphate (cAMP) plays a crucial role in regulating pituitary cell proliferation and hormone synthesis. Recent evidence suggests that exchange proteins directly activated by cAMP (Epacs) may mediate the effects of cAMP. Here we used rat anterior pituitary GH3
Kazuya Kusama et al.
Reproduction (Cambridge, England), 147(6), 897-906 (2014-03-04)
The optimal decidualization of endometrial stromal cells (ESCs) following embryo implantation is one of the critical steps to establish pregnancy in rodents and humans. This step is intricately regulated by ovarian hormones. Using in vitro human ESCs model, we previously