Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
ATGCCTGGCTTCGACTACAAGTTCCTGGAGAAGCCCAAGCGACGGCTGCTGTGCCCACTGTGCGGGAAGCCCATGCGCGAGCCTGTGCAGGTTTCCACCTGCGGCCACCGTTTCTGCGATACCTGCCTGCAGGAGTTCCTCAGTGAAGGAGTCTTCAAGTGCCCTGAGGACCAGCTTCCTCTGGACTATGCCAAGATCTACCCAGACCCGGAGCTGGAAGTACAAGTATTGGGCCTGCCTATCCGCTGCATCCACAGTGAGGAGGGCTGCCGCTGGAGTGGGCCACTACGTCATCTACAGGGCCACCTGAATACCTGCAGCTTCAATGTCATTCCCTGCCCTAATCGCTGCCCCATGAAGCTGAGCCGCCGTGATCTACCTGCACACTTGCAGCATGACTG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... TRAF4(9618)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Liulin Tang et al.
Human cell, 33(3), 801-809 (2020-05-11)
Endometrial cancer (EC) is one of the most common cancers among females worldwide. Advanced stage patients of EC have poor prognosis. Inevitable side effects and treatment tolerance of chemotherapy for EC remain to be addressed. Our results in this study
EunGi Kim et al.
Scientific reports, 7(1), 8923-8923 (2017-08-23)
Normal fibroblasts surrounding tumor cells play a crucial role in cancer progression through formation of the tumor microenvironment. Because factors secreted from normal fibroblasts can modulate the tumor microenvironment, it is necessary to identify key factors associated with regulation of
Hua-Yan Ren et al.
Oncotarget, 6(6), 4080-4096 (2015-03-05)
Tumor necrosis factor receptor associated factor 4 (TRAF4) is an important adaptor protein that plays a significant role in several signaling pathways. By studying the relationship between TRAF4 and 70 kDa ribosomal protein S6 kinase (p70s6k) in vivo, we demonstrated