Skip to Content
Merck

EHU085421

MISSION® esiRNA

targeting human TRAF4

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATGCCTGGCTTCGACTACAAGTTCCTGGAGAAGCCCAAGCGACGGCTGCTGTGCCCACTGTGCGGGAAGCCCATGCGCGAGCCTGTGCAGGTTTCCACCTGCGGCCACCGTTTCTGCGATACCTGCCTGCAGGAGTTCCTCAGTGAAGGAGTCTTCAAGTGCCCTGAGGACCAGCTTCCTCTGGACTATGCCAAGATCTACCCAGACCCGGAGCTGGAAGTACAAGTATTGGGCCTGCCTATCCGCTGCATCCACAGTGAGGAGGGCTGCCGCTGGAGTGGGCCACTACGTCATCTACAGGGCCACCTGAATACCTGCAGCTTCAATGTCATTCCCTGCCCTAATCGCTGCCCCATGAAGCTGAGCCGCCGTGATCTACCTGCACACTTGCAGCATGACTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... TRAF4(9618)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Liulin Tang et al.
Human cell, 33(3), 801-809 (2020-05-11)
Endometrial cancer (EC) is one of the most common cancers among females worldwide. Advanced stage patients of EC have poor prognosis. Inevitable side effects and treatment tolerance of chemotherapy for EC remain to be addressed. Our results in this study
EunGi Kim et al.
Scientific reports, 7(1), 8923-8923 (2017-08-23)
Normal fibroblasts surrounding tumor cells play a crucial role in cancer progression through formation of the tumor microenvironment. Because factors secreted from normal fibroblasts can modulate the tumor microenvironment, it is necessary to identify key factors associated with regulation of
Hua-Yan Ren et al.
Oncotarget, 6(6), 4080-4096 (2015-03-05)
Tumor necrosis factor receptor associated factor 4 (TRAF4) is an important adaptor protein that plays a significant role in several signaling pathways. By studying the relationship between TRAF4 and 70 kDa ribosomal protein S6 kinase (p70s6k) in vivo, we demonstrated