Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CTTGGCTTCCTTGTGCCTTAAAAAACCTGCCTTCCTGCAGCCACACACCCACCCGGGGTGTCCTGGGGACCCAAGGGGTGGGGGGGTCACACCAGAGAGAGGCAGGGGGCCTGGCCGGCTCCTGCAGGATCATGCAGCTGGGGCGCGGCGGCCGCGGCTGCGACACCCCAACCCCAGCCCTCTAATCAAGTCACGTGATTCTCCCTTCACCCCGCCCCCAGGGCCTTCCCTTCTGCCCCCAGGCGGGCTCCCCGCTGCTCCAGCTGCGGAGCTGGTCGACATAATCTCTGTATTATATACTTTGCAGTTGCAGACGTCTGTGCCTAGCAATATTTCCAGTTGACCAAATATTCTAATCTTTTTTCATTTATATGCAAAAGAAATAGTTTTAAGTAACTTTTTATAGCAAGATGATACAATGGTATGAGTG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... PTBP1(5725)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Kohei Taniguchi et al.
International journal of molecular sciences, 19(5) (2018-04-27)
Pyruvate kinase is known as the glycolytic enzyme catalyzing the final step in glycolysis. In mammals, two different forms of it exist, i.e., pyruvate kinase M1/2 (PKM) and pyruvate kinase L/R (PKLR). Also, PKM has two isoforms, i.e., PKM1 and
Xin Fu et al.
Biochimica et biophysica acta. Molecular cell research, 1865(11 Pt A), 1552-1565 (2018-10-18)
Mesenchymal stem cells (MSCs) hold great promise as attractive vehicles to deliver therapeutic agents against cancer, while the cross-talk between MSCs and cancer cells remains controversial. Here in an indirect co-culture system we observed that MSCs induced the malignancy transformation
High expression of PTBP1 promote invasion of colorectal cancer by alternative splicing of cortactin.
Zhi-Na Wang et al.
Oncotarget, 8(22), 36185-36202 (2017-04-14)
Polypyrimidine tract-binding protein 1 (PTBP1) involving in almost all steps of mRNA regulation including alternative splicing metabolism during tumorigenesis due to its RNA-binding activity. Initially, we found that high expressed PTBP1 and poor prognosis was interrelated in colorectal cancer (CRC)